Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125100181:

Variant ID: vg1125100181 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25100181
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAATGCACGTCAGAAAAATTGTTTGTGATGTGTCAACGTCAGGAAAATTCCGTCAGGACTAGCTTGTCAGAGAAAAATAAATTTAGGTGACGGAGGCGC[A/G]
TCAGGATTAATTTTCCTGACGTGTACTCACGTCAGGGATACTTTTCCTGACGTTGATGTGAGCAGTCATCGATATTCATCTATCGCTGATGGTCTCCCCT

Reverse complement sequence

AGGGGAGACCATCAGCGATAGATGAATATCGATGACTGCTCACATCAACGTCAGGAAAAGTATCCCTGACGTGAGTACACGTCAGGAAAATTAATCCTGA[T/C]
GCGCCTCCGTCACCTAAATTTATTTTTCTCTGACAAGCTAGTCCTGACGGAATTTTCCTGACGTTGACACATCACAAACAATTTTTCTGACGTGCATTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 9.50% 1.31% 0.00% NA
All Indica  2759 98.70% 0.90% 0.40% 0.00% NA
All Japonica  1512 69.40% 27.40% 3.17% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.50% 0.34% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 97.50% 1.70% 0.89% 0.00% NA
Temperate Japonica  767 46.20% 49.70% 4.17% 0.00% NA
Tropical Japonica  504 96.60% 1.60% 1.79% 0.00% NA
Japonica Intermediate  241 86.30% 10.80% 2.90% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125100181 A -> G LOC_Os11g41770.1 downstream_gene_variant ; 606.0bp to feature; MODIFIER silent_mutation Average:27.963; most accessible tissue: Callus, score: 54.677 N N N N
vg1125100181 A -> G LOC_Os11g41780.1 downstream_gene_variant ; 3566.0bp to feature; MODIFIER silent_mutation Average:27.963; most accessible tissue: Callus, score: 54.677 N N N N
vg1125100181 A -> G LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:27.963; most accessible tissue: Callus, score: 54.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125100181 3.70E-10 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 2.88E-07 2.60E-07 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 1.05E-08 2.78E-22 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 NA 2.11E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 7.97E-13 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 8.06E-11 5.94E-08 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 2.27E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 NA 1.20E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 1.79E-07 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 2.03E-06 NA mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 5.98E-06 1.15E-06 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 8.08E-11 NA mr1609 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 2.96E-11 2.96E-11 mr1609 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 1.46E-09 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 3.29E-08 2.08E-06 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 2.30E-11 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 1.30E-10 3.39E-10 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 1.68E-09 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 NA 1.84E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 5.81E-09 2.42E-15 mr1959 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 8.26E-06 2.21E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 5.49E-11 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 3.10E-08 1.01E-06 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 1.55E-10 6.98E-32 mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 NA 2.06E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 6.88E-10 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 5.23E-06 5.23E-06 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 3.24E-12 NA mr1609_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 8.92E-11 8.92E-11 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 2.23E-14 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 4.80E-11 2.43E-08 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 2.97E-12 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 2.56E-09 1.86E-08 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 7.24E-07 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 1.96E-08 4.68E-18 mr1959_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125100181 NA 1.54E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251