\
| Variant ID: vg1125091275 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25091275 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )
AATTAACTGAGTGCAATAAAAACTTCCGTTATCTTAAAGAAAATCAATGACACCAGATACACCTACCGATACATATGCAAAAGTTGTTATTGTATCTACT[A/G,C]
CGCCTTCTCCTTTAAATACATTTTATTTATTTTCGCGCAACGTTCCATTGCATTCTGAGAAATTAATATCCAAACTATTCTTGTGATATATACTTCCTCC
GGAGGAAGTATATATCACAAGAATAGTTTGGATATTAATTTCTCAGAATGCAATGGAACGTTGCGCGAAAATAAATAAAATGTATTTAAAGGAGAAGGCG[T/C,G]
AGTAGATACAATAACAACTTTTGCATATGTATCGGTAGGTGTATCTGGTGTCATTGATTTTCTTTAAGATAACGGAAGTTTTTATTGCACTCAGTTAATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 6.90% | 0.28% | 0.00% | C: 0.02% |
| All Indica | 2759 | 99.30% | 0.30% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 81.70% | 18.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 0.60% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 91.30% | 8.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 0.00% | C: 1.04% |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125091275 | A -> G | LOC_Os11g41760-LOC_Os11g41770 | intergenic_region ; MODIFIER | silent_mutation | Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg1125091275 | A -> C | LOC_Os11g41760-LOC_Os11g41770 | intergenic_region ; MODIFIER | silent_mutation | Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125091275 | 2.58E-10 | NA | mr1238 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | NA | 5.04E-07 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 9.16E-08 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | NA | 5.71E-06 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 7.91E-08 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 7.98E-06 | 1.14E-06 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | NA | 2.26E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 3.36E-08 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | NA | 1.11E-06 | mr1841 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 4.83E-09 | 2.26E-16 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | NA | 3.54E-08 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 1.32E-06 | NA | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | NA | 3.69E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 3.57E-10 | NA | mr1238_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 6.61E-09 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | NA | 2.99E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 1.42E-08 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 1.01E-08 | NA | mr1900_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 3.28E-08 | 3.61E-07 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125091275 | 4.18E-07 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |