| Variant ID: vg1125090609 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25090609 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 295. )
AAAACTTGTCGGTCTCTACTAGAGCACCTAGATCCATGCATAATATTTTGTTCCTGACTAGGATGAGCTCGATCCGGGCTGGCCGAAGAGGAACAAGAAC[T/G]
TAGCTAGGTTGGTCTTACCAATCCAATTACCTAGTTACGTTCAATCTAAATGAAATACTAGACACTCATTTTTGCACCAGAGCCTACTATGTAATTTTTT
AAAAAATTACATAGTAGGCTCTGGTGCAAAAATGAGTGTCTAGTATTTCATTTAGATTGAACGTAACTAGGTAATTGGATTGGTAAGACCAACCTAGCTA[A/C]
GTTCTTGTTCCTCTTCGGCCAGCCCGGATCGAGCTCATCCTAGTCAGGAACAAAATATTATGCATGGATCTAGGTGCTCTAGTAGAGACCGACAAGTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 4.80% | 0.00% | 0.59% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.00% | 0.04% | NA |
| All Japonica | 1512 | 84.60% | 14.30% | 0.00% | 1.12% | NA |
| Aus | 269 | 95.50% | 1.50% | 0.00% | 2.97% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 74.70% | 23.60% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 98.00% | 1.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 88.00% | 10.80% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125090609 | T -> DEL | N | N | silent_mutation | Average:52.14; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg1125090609 | T -> G | LOC_Os11g41760-LOC_Os11g41770 | intergenic_region ; MODIFIER | silent_mutation | Average:52.14; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125090609 | 4.03E-26 | 1.81E-29 | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125090609 | 1.07E-13 | 3.46E-09 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125090609 | 5.00E-15 | NA | mr1300 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125090609 | 6.12E-10 | NA | mr1300 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125090609 | 4.21E-22 | 3.35E-27 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125090609 | 3.35E-13 | 2.44E-09 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125090609 | 3.19E-18 | NA | mr1310 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125090609 | 1.94E-10 | NA | mr1310 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125090609 | 4.38E-20 | 1.15E-23 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125090609 | 1.31E-12 | 2.03E-09 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/