\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125087812:

Variant ID: vg1125087812 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25087812
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.08, T: 0.07, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


CGTACATTTGGGCTGAGGCATTTCTTTTTTTTTGGGTGATTTTTGATATCTGTGACGGGTGAGAACTAAAACCAGTCACAGCTGTTTCGTCACCTTTGAC[A/G,T]
GGTTGCAAAGAGTCACCCGTCACAGGTGTGAGTCACCTGTGACGGCTATATTTTTTAGCCCGTCAAAGGTTTTAATTACCAGTGACGGGCTTTCACCCGT

Reverse complement sequence

ACGGGTGAAAGCCCGTCACTGGTAATTAAAACCTTTGACGGGCTAAAAAATATAGCCGTCACAGGTGACTCACACCTGTGACGGGTGACTCTTTGCAACC[T/C,A]
GTCAAAGGTGACGAAACAGCTGTGACTGGTTTTAGTTCTCACCCGTCACAGATATCAAAAATCACCCAAAAAAAAAGAAATGCCTCAGCCCAAATGTACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 32.60% 0.87% 4.32% T: 1.25%
All Indica  2759 61.10% 37.50% 0.83% 0.11% T: 0.43%
All Japonica  1512 71.40% 14.40% 1.06% 12.96% T: 0.20%
Aus  269 4.50% 79.60% 0.00% 0.74% T: 15.24%
Indica I  595 61.70% 37.80% 0.34% 0.00% T: 0.17%
Indica II  465 65.20% 34.20% 0.22% 0.00% T: 0.43%
Indica III  913 54.50% 44.70% 0.55% 0.11% T: 0.11%
Indica Intermediate  786 66.00% 30.80% 1.91% 0.25% T: 1.02%
Temperate Japonica  767 66.50% 10.30% 1.56% 21.25% T: 0.39%
Tropical Japonica  504 85.50% 12.50% 0.20% 1.79% NA
Japonica Intermediate  241 57.70% 31.10% 1.24% 9.96% NA
VI/Aromatic  96 47.90% 49.00% 1.04% 1.04% T: 1.04%
Intermediate  90 62.20% 32.20% 1.11% 2.22% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125087812 A -> T LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:35.432; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1125087812 A -> DEL N N silent_mutation Average:35.432; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1125087812 A -> G LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:35.432; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125087812 2.46E-06 5.45E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 2.19E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 6.11E-07 NA mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 6.99E-06 NA mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 1.99E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 3.10E-07 NA mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 3.31E-06 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 1.46E-06 NA mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 NA 2.73E-07 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 4.17E-08 1.14E-06 mr1841 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 1.22E-08 NA mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 2.51E-06 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 NA 1.18E-11 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 NA 1.11E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 6.33E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 1.62E-07 NA mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087812 3.44E-07 NA mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251