\
| Variant ID: vg1125087670 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25087670 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGTTAAAATGGACATGGATACTTGTGTGATGTATATTGTCAAATTGCTTCATGTGTAGTTGTTTGTTGAGATGTATTTGATTTAAAATACAAAGTTGTT[G/T]
TATCATGTGCATCTTGAGATGTATTTGATTTTTCTTCATTTCGTACATTTGGGCTGAGGCATTTCTTTTTTTTTGGGTGATTTTTGATATCTGTGACGGG
CCCGTCACAGATATCAAAAATCACCCAAAAAAAAAGAAATGCCTCAGCCCAAATGTACGAAATGAAGAAAAATCAAATACATCTCAAGATGCACATGATA[C/A]
AACAACTTTGTATTTTAAATCAAATACATCTCAACAAACAACTACACATGAAGCAATTTGACAATATACATCACACAAGTATCCATGTCCATTTTAACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 3.80% | 0.42% | 4.30% | NA |
| All Indica | 2759 | 99.30% | 0.10% | 0.47% | 0.11% | NA |
| All Japonica | 1512 | 75.10% | 11.60% | 0.33% | 12.90% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.37% | 0.74% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.10% | 0.33% | 0.11% | NA |
| Indica Intermediate | 786 | 98.50% | 0.00% | 1.27% | 0.25% | NA |
| Temperate Japonica | 767 | 73.50% | 5.00% | 0.65% | 20.86% | NA |
| Tropical Japonica | 504 | 75.00% | 23.20% | 0.00% | 1.79% | NA |
| Japonica Intermediate | 241 | 80.50% | 8.70% | 0.00% | 10.79% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125087670 | G -> T | LOC_Os11g41760-LOC_Os11g41770 | intergenic_region ; MODIFIER | silent_mutation | Average:27.571; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg1125087670 | G -> DEL | N | N | silent_mutation | Average:27.571; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125087670 | 9.68E-06 | 2.53E-06 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125087670 | NA | 7.38E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125087670 | 3.36E-07 | NA | mr1925 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125087670 | NA | 8.72E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125087670 | 3.81E-07 | 7.08E-08 | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125087670 | 3.58E-07 | 3.58E-07 | mr1484_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125087670 | NA | 7.79E-06 | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125087670 | 2.89E-06 | 2.89E-06 | mr1945_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |