\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125087670:

Variant ID: vg1125087670 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25087670
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTTAAAATGGACATGGATACTTGTGTGATGTATATTGTCAAATTGCTTCATGTGTAGTTGTTTGTTGAGATGTATTTGATTTAAAATACAAAGTTGTT[G/T]
TATCATGTGCATCTTGAGATGTATTTGATTTTTCTTCATTTCGTACATTTGGGCTGAGGCATTTCTTTTTTTTTGGGTGATTTTTGATATCTGTGACGGG

Reverse complement sequence

CCCGTCACAGATATCAAAAATCACCCAAAAAAAAAGAAATGCCTCAGCCCAAATGTACGAAATGAAGAAAAATCAAATACATCTCAAGATGCACATGATA[C/A]
AACAACTTTGTATTTTAAATCAAATACATCTCAACAAACAACTACACATGAAGCAATTTGACAATATACATCACACAAGTATCCATGTCCATTTTAACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 3.80% 0.42% 4.30% NA
All Indica  2759 99.30% 0.10% 0.47% 0.11% NA
All Japonica  1512 75.10% 11.60% 0.33% 12.90% NA
Aus  269 98.90% 0.00% 0.37% 0.74% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.10% 0.33% 0.11% NA
Indica Intermediate  786 98.50% 0.00% 1.27% 0.25% NA
Temperate Japonica  767 73.50% 5.00% 0.65% 20.86% NA
Tropical Japonica  504 75.00% 23.20% 0.00% 1.79% NA
Japonica Intermediate  241 80.50% 8.70% 0.00% 10.79% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 93.30% 3.30% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125087670 G -> T LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:27.571; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1125087670 G -> DEL N N silent_mutation Average:27.571; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125087670 9.68E-06 2.53E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670 NA 7.38E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670 3.36E-07 NA mr1925 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670 NA 8.72E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670 3.81E-07 7.08E-08 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670 3.58E-07 3.58E-07 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670 NA 7.79E-06 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670 2.89E-06 2.89E-06 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251