\
| Variant ID: vg1125085953 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25085953 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCAGAGGTGAGGTTTACTCACCTCAAACGGCTTTAAGTCCCAGCCCGTTTGAGATGACTTCTGCCACTGTATATATATATATATGTCTTCTCTCCCAGC[G/A]
GGGCCCACATGAGGAGATAAGGTCGGCCGGCTCCCTCTTCTCCACTTCTCCTCTATCTCTTCCACTTCTTCTCTATCTCTCCTCTCTTTCTCTATGCCGT
ACGGCATAGAGAAAGAGAGGAGAGATAGAGAAGAAGTGGAAGAGATAGAGGAGAAGTGGAGAAGAGGGAGCCGGCCGACCTTATCTCCTCATGTGGGCCC[C/T]
GCTGGGAGAGAAGACATATATATATATATACAGTGGCAGAAGTCATCTCAAACGGGCTGGGACTTAAAGCCGTTTGAGGTGAGTAAACCTCACCTCTGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 1.50% | 7.79% | 4.10% | NA |
| All Indica | 2759 | 97.50% | 0.80% | 1.41% | 0.33% | NA |
| All Japonica | 1512 | 69.50% | 1.30% | 17.39% | 11.77% | NA |
| Aus | 269 | 73.60% | 9.70% | 14.87% | 1.86% | NA |
| Indica I | 595 | 97.80% | 0.50% | 0.84% | 0.84% | NA |
| Indica II | 465 | 98.50% | 0.00% | 1.29% | 0.22% | NA |
| Indica III | 913 | 96.70% | 1.10% | 2.08% | 0.11% | NA |
| Indica Intermediate | 786 | 97.50% | 1.10% | 1.15% | 0.25% | NA |
| Temperate Japonica | 767 | 72.20% | 0.70% | 7.69% | 19.43% | NA |
| Tropical Japonica | 504 | 68.50% | 2.60% | 27.38% | 1.59% | NA |
| Japonica Intermediate | 241 | 63.10% | 0.80% | 27.39% | 8.71% | NA |
| VI/Aromatic | 96 | 76.00% | 3.10% | 19.79% | 1.04% | NA |
| Intermediate | 90 | 88.90% | 2.20% | 7.78% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125085953 | G -> A | LOC_Os11g41760-LOC_Os11g41770 | intergenic_region ; MODIFIER | silent_mutation | Average:55.342; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| vg1125085953 | G -> DEL | N | N | silent_mutation | Average:55.342; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125085953 | NA | 8.19E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | NA | 3.47E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 1.92E-11 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | NA | 1.48E-06 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 2.71E-09 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 1.31E-07 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | NA | 3.25E-06 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | NA | 4.26E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 1.18E-11 | NA | mr1841 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | NA | 2.57E-06 | mr1841 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 1.12E-10 | 5.89E-17 | mr1900 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | NA | 8.70E-08 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 1.71E-08 | 2.32E-07 | mr1925 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 3.46E-06 | NA | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | NA | 2.30E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 6.91E-10 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 1.09E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 5.46E-06 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | NA | 4.73E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 9.24E-10 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 2.57E-08 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 3.61E-09 | 2.55E-08 | mr1925_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | 2.97E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125085953 | NA | 2.66E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |