\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125085416:

Variant ID: vg1125085416 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25085416
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CTAACCACATACATATATACACCATTTCGCTCGCTGTAAAGATAAATTTGCTAACAACTGCCACACTTCATTCGATCTTGCTCCTGCAAATTGAGGTGTA[A/G]
CTAACTCCAAATTTAATAAAGGTTTATATATTTACATGTTCTAGTTTCCCCTGGGTACTCCATTTAGTAGATGCATGTTTGCTCGATACAGACTTTTTAA

Reverse complement sequence

TTAAAAAGTCTGTATCGAGCAAACATGCATCTACTAAATGGAGTACCCAGGGGAAACTAGAACATGTAAATATATAAACCTTTATTAAATTTGGAGTTAG[T/C]
TACACCTCAATTTGCAGGAGCAAGATCGAATGAAGTGTGGCAGTTGTTAGCAAATTTATCTTTACAGCGAGCGAAATGGTGTATATATGTATGTGGTTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 10.50% 0.34% 4.13% NA
All Indica  2759 87.40% 12.40% 0.11% 0.11% NA
All Japonica  1512 85.90% 0.90% 0.86% 12.37% NA
Aus  269 58.40% 40.50% 0.00% 1.12% NA
Indica I  595 97.00% 2.70% 0.34% 0.00% NA
Indica II  465 88.80% 11.00% 0.22% 0.00% NA
Indica III  913 79.20% 20.70% 0.00% 0.11% NA
Indica Intermediate  786 88.80% 10.90% 0.00% 0.25% NA
Temperate Japonica  767 78.20% 0.30% 1.04% 20.47% NA
Tropical Japonica  504 97.60% 0.60% 0.00% 1.79% NA
Japonica Intermediate  241 85.90% 3.30% 2.07% 8.71% NA
VI/Aromatic  96 74.00% 25.00% 0.00% 1.04% NA
Intermediate  90 91.10% 7.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125085416 A -> DEL N N silent_mutation Average:36.999; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg1125085416 A -> G LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:36.999; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125085416 1.63E-18 3.68E-21 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125085416 2.11E-13 7.04E-16 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125085416 3.54E-09 1.36E-10 mr1484 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125085416 3.40E-10 3.23E-13 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125085416 4.99E-10 4.99E-10 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125085416 1.44E-11 5.58E-15 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125085416 1.35E-12 5.76E-16 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125085416 4.54E-06 1.08E-07 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125085416 1.73E-16 8.62E-21 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125085416 2.54E-08 2.74E-12 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125085416 1.55E-12 1.55E-12 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251