\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125084815:

Variant ID: vg1125084815 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25084815
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.24, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAATGGCTAGGACTGTTAGCATCAGGGTGTGTTTAGTTCACGTTAAAATTAGAAGTTTGGTTGAAATTGGAACAATATGACAGAAAAGTTATAAGTTT[A/G]
TGTGTCTAGAAAAGTTTCGATGTGATAGAAAAGTTAAAAGTTTGAAGAAATAGTTTGGAACTAAACTCGGCCTCAGTATAGAAATGTGACGACGATCGAG

Reverse complement sequence

CTCGATCGTCGTCACATTTCTATACTGAGGCCGAGTTTAGTTCCAAACTATTTCTTCAAACTTTTAACTTTTCTATCACATCGAAACTTTTCTAGACACA[T/C]
AAACTTATAACTTTTCTGTCATATTGTTCCAATTTCAACCAAACTTCTAATTTTAACGTGAACTAAACACACCCTGATGCTAACAGTCCTAGCCATTACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 22.70% 0.53% 4.53% NA
All Indica  2759 80.10% 19.00% 0.65% 0.22% NA
All Japonica  1512 62.80% 23.50% 0.26% 13.36% NA
Aus  269 44.60% 54.30% 0.00% 1.12% NA
Indica I  595 65.50% 33.90% 0.34% 0.17% NA
Indica II  465 75.90% 23.90% 0.00% 0.22% NA
Indica III  913 89.20% 10.20% 0.44% 0.22% NA
Indica Intermediate  786 83.20% 15.00% 1.53% 0.25% NA
Temperate Japonica  767 62.20% 15.80% 0.26% 21.77% NA
Tropical Japonica  504 67.70% 30.60% 0.00% 1.79% NA
Japonica Intermediate  241 54.80% 33.60% 0.83% 10.79% NA
VI/Aromatic  96 72.90% 25.00% 1.04% 1.04% NA
Intermediate  90 68.90% 26.70% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125084815 A -> DEL N N silent_mutation Average:43.804; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1125084815 A -> G LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:43.804; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125084815 4.23E-09 5.64E-13 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 3.84E-11 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.20E-18 2.85E-18 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 3.06E-06 NA mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 3.81E-07 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 8.53E-14 1.94E-14 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 4.05E-06 NA mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 8.59E-09 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.54E-19 4.37E-19 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 5.32E-08 5.46E-08 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 3.18E-08 3.18E-08 mr1498 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 4.87E-09 4.87E-09 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 4.33E-09 5.11E-14 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.08E-07 NA mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.74E-19 3.36E-19 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 2.74E-07 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.87E-17 2.63E-17 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.35E-06 5.80E-08 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.55E-07 1.55E-07 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.49E-08 3.48E-08 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 2.00E-08 2.15E-19 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 9.70E-09 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 8.22E-16 7.04E-14 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 4.52E-07 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 8.88E-08 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 3.40E-09 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.81E-12 1.81E-12 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 3.56E-09 3.57E-09 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 NA 2.49E-08 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 NA 5.61E-06 mr1728_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 NA 1.43E-08 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 5.11E-10 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 2.71E-18 4.80E-16 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.45E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 9.35E-17 2.38E-15 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 1.35E-07 1.35E-07 mr1925_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 2.63E-07 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 7.52E-10 7.53E-10 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125084815 4.20E-06 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251