\
| Variant ID: vg1125084815 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25084815 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.24, others allele: 0.00, population size: 68. )
AGTAATGGCTAGGACTGTTAGCATCAGGGTGTGTTTAGTTCACGTTAAAATTAGAAGTTTGGTTGAAATTGGAACAATATGACAGAAAAGTTATAAGTTT[A/G]
TGTGTCTAGAAAAGTTTCGATGTGATAGAAAAGTTAAAAGTTTGAAGAAATAGTTTGGAACTAAACTCGGCCTCAGTATAGAAATGTGACGACGATCGAG
CTCGATCGTCGTCACATTTCTATACTGAGGCCGAGTTTAGTTCCAAACTATTTCTTCAAACTTTTAACTTTTCTATCACATCGAAACTTTTCTAGACACA[T/C]
AAACTTATAACTTTTCTGTCATATTGTTCCAATTTCAACCAAACTTCTAATTTTAACGTGAACTAAACACACCCTGATGCTAACAGTCCTAGCCATTACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.20% | 22.70% | 0.53% | 4.53% | NA |
| All Indica | 2759 | 80.10% | 19.00% | 0.65% | 0.22% | NA |
| All Japonica | 1512 | 62.80% | 23.50% | 0.26% | 13.36% | NA |
| Aus | 269 | 44.60% | 54.30% | 0.00% | 1.12% | NA |
| Indica I | 595 | 65.50% | 33.90% | 0.34% | 0.17% | NA |
| Indica II | 465 | 75.90% | 23.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 89.20% | 10.20% | 0.44% | 0.22% | NA |
| Indica Intermediate | 786 | 83.20% | 15.00% | 1.53% | 0.25% | NA |
| Temperate Japonica | 767 | 62.20% | 15.80% | 0.26% | 21.77% | NA |
| Tropical Japonica | 504 | 67.70% | 30.60% | 0.00% | 1.79% | NA |
| Japonica Intermediate | 241 | 54.80% | 33.60% | 0.83% | 10.79% | NA |
| VI/Aromatic | 96 | 72.90% | 25.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 68.90% | 26.70% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125084815 | A -> DEL | N | N | silent_mutation | Average:43.804; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| vg1125084815 | A -> G | LOC_Os11g41760-LOC_Os11g41770 | intergenic_region ; MODIFIER | silent_mutation | Average:43.804; most accessible tissue: Zhenshan97 young leaf, score: 61.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125084815 | 4.23E-09 | 5.64E-13 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 3.84E-11 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.20E-18 | 2.85E-18 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 3.06E-06 | NA | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 3.81E-07 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 8.53E-14 | 1.94E-14 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 4.05E-06 | NA | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 8.59E-09 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.54E-19 | 4.37E-19 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 5.32E-08 | 5.46E-08 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 3.18E-08 | 3.18E-08 | mr1498 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 4.87E-09 | 4.87E-09 | mr1609 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 4.33E-09 | 5.11E-14 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.08E-07 | NA | mr1841 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.74E-19 | 3.36E-19 | mr1841 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 2.74E-07 | NA | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.87E-17 | 2.63E-17 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.35E-06 | 5.80E-08 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.55E-07 | 1.55E-07 | mr1945 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.49E-08 | 3.48E-08 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 2.00E-08 | 2.15E-19 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 9.70E-09 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 8.22E-16 | 7.04E-14 | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 4.52E-07 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 8.88E-08 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 3.40E-09 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.81E-12 | 1.81E-12 | mr1484_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 3.56E-09 | 3.57E-09 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | NA | 2.49E-08 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | NA | 5.61E-06 | mr1728_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | NA | 1.43E-08 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 5.11E-10 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 2.71E-18 | 4.80E-16 | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.45E-07 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 9.35E-17 | 2.38E-15 | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 1.35E-07 | 1.35E-07 | mr1925_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 2.63E-07 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 7.52E-10 | 7.53E-10 | mr1945_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125084815 | 4.20E-06 | NA | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |