\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125082418:

Variant ID: vg1125082418 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25082418
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.33, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACTGGGTATAATAGGGATGGCGGTTGCTGGTGATATCAAGAAACCACTAGACTTGGACAACGACTTGCTAGAGTGGAGGGGTGATTATTTGACCTAT[C/T]
GACTTTAAGATTCGTTGTGGATGATGCGGAAAACATTTAGAGCCAACAGTGAATTTTACTTTAGATTAAACTTGTCTCCTAGCTTACTAGTAAAACAACA

Reverse complement sequence

TGTTGTTTTACTAGTAAGCTAGGAGACAAGTTTAATCTAAAGTAAAATTCACTGTTGGCTCTAAATGTTTTCCGCATCATCCACAACGAATCTTAAAGTC[G/A]
ATAGGTCAAATAATCACCCCTCCACTCTAGCAAGTCGTTGTCCAAGTCTAGTGGTTTCTTGATATCACCAGCAACCGCCATCCCTATTATACCCAGTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 19.40% 0.61% 0.89% NA
All Indica  2759 81.70% 17.50% 0.72% 0.07% NA
All Japonica  1512 76.10% 21.80% 0.33% 1.85% NA
Aus  269 62.80% 33.10% 0.37% 3.72% NA
Indica I  595 65.90% 33.80% 0.17% 0.17% NA
Indica II  465 76.80% 23.20% 0.00% 0.00% NA
Indica III  913 91.70% 7.90% 0.44% 0.00% NA
Indica Intermediate  786 85.00% 13.00% 1.91% 0.13% NA
Temperate Japonica  767 69.90% 28.00% 0.00% 2.09% NA
Tropical Japonica  504 91.10% 7.10% 0.40% 1.39% NA
Japonica Intermediate  241 64.30% 32.40% 1.24% 2.07% NA
VI/Aromatic  96 96.90% 1.00% 1.04% 1.04% NA
Intermediate  90 81.10% 15.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125082418 C -> T LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:30.88; most accessible tissue: Minghui63 young leaf, score: 50.756 N N N N
vg1125082418 C -> DEL N N silent_mutation Average:30.88; most accessible tissue: Minghui63 young leaf, score: 50.756 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125082418 1.24E-07 1.86E-11 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 2.40E-10 7.96E-07 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 4.28E-07 NA mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 7.86E-13 2.54E-07 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 3.96E-07 NA mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 1.03E-10 1.60E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 6.46E-06 6.47E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 1.74E-08 2.39E-13 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 1.52E-11 1.04E-08 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 3.06E-13 1.91E-07 mr1900 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 1.10E-07 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 2.61E-06 2.61E-06 mr1945 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 1.52E-09 4.20E-06 mr1959 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 6.38E-08 1.34E-18 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 2.64E-09 NA mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 7.24E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 5.31E-07 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 NA 8.16E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 NA 2.31E-08 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 NA 1.36E-08 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 6.70E-12 4.05E-07 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 1.84E-11 1.89E-07 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125082418 2.39E-06 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251