\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125081311:

Variant ID: vg1125081311 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25081311
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.12, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCGGTCTAGCAAAAATATCTCGAGATAAAGGTACCTCATGGTACTACGTATATCGTTTCTGATCGTTGGATCTAGCTGGGTAGAAAGGCATACGATT[A/G]
GAAACGATTTGATCGGAAACAATTTGGTACTGTGAGGTATCGTTACCTCCAGATACTTTTTGTTGGACCGAAGCAAATCTCATAATAAAATTTGCATGCA

Reverse complement sequence

TGCATGCAAATTTTATTATGAGATTTGCTTCGGTCCAACAAAAAGTATCTGGAGGTAACGATACCTCACAGTACCAAATTGTTTCCGATCAAATCGTTTC[T/C]
AATCGTATGCCTTTCTACCCAGCTAGATCCAACGATCAGAAACGATATACGTAGTACCATGAGGTACCTTTATCTCGAGATATTTTTGCTAGACCGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 42.30% 0.85% 0.30% NA
All Indica  2759 71.20% 28.10% 0.72% 0.00% NA
All Japonica  1512 28.40% 69.60% 1.06% 0.93% NA
Aus  269 68.00% 32.00% 0.00% 0.00% NA
Indica I  595 63.00% 36.50% 0.50% 0.00% NA
Indica II  465 56.60% 43.20% 0.22% 0.00% NA
Indica III  913 85.20% 14.30% 0.44% 0.00% NA
Indica Intermediate  786 69.70% 28.80% 1.53% 0.00% NA
Temperate Japonica  767 8.90% 87.60% 1.83% 1.69% NA
Tropical Japonica  504 57.30% 42.50% 0.00% 0.20% NA
Japonica Intermediate  241 30.30% 68.90% 0.83% 0.00% NA
VI/Aromatic  96 51.00% 47.90% 1.04% 0.00% NA
Intermediate  90 52.20% 44.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125081311 A -> DEL N N silent_mutation Average:32.725; most accessible tissue: Zhenshan97 young leaf, score: 57.78 N N N N
vg1125081311 A -> G LOC_Os11g41760.1 upstream_gene_variant ; 4285.0bp to feature; MODIFIER silent_mutation Average:32.725; most accessible tissue: Zhenshan97 young leaf, score: 57.78 N N N N
vg1125081311 A -> G LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:32.725; most accessible tissue: Zhenshan97 young leaf, score: 57.78 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125081311 9.95E-09 1.18E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 3.97E-10 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 4.44E-11 9.88E-12 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 3.78E-08 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 9.08E-09 2.28E-09 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 3.84E-10 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 5.07E-11 1.21E-11 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 5.22E-06 NA mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 3.59E-09 1.56E-15 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 1.95E-10 NA mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 2.23E-10 8.61E-11 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 6.33E-08 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 1.16E-09 8.33E-12 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 1.19E-07 2.58E-16 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 2.55E-09 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 2.40E-09 4.27E-10 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 2.78E-08 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 3.11E-09 3.11E-09 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 2.33E-06 2.33E-06 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 2.54E-10 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 1.65E-09 6.59E-10 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 3.86E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 2.06E-08 3.60E-09 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 1.03E-07 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125081311 9.20E-10 9.20E-10 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251