\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125079888:

Variant ID: vg1125079888 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25079888
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTACCACACAACAATTTTCTATTTAATTTCACCACCTACTACATTATCTCAACCAATCCGAACTTTCTTTCTATCAATTTTATCGCTCTTCTTAATC[T/C]
CTTAAAGAAATAAAGATATTGAGGGAGTACCTGATTAATTAAGATGTTCAAGTTACTACTAAGCATGCTTACATATATGCGTTTGTTTGGCATCTTTGAA

Reverse complement sequence

TTCAAAGATGCCAAACAAACGCATATATGTAAGCATGCTTAGTAGTAACTTGAACATCTTAATTAATCAGGTACTCCCTCAATATCTTTATTTCTTTAAG[A/G]
GATTAAGAAGAGCGATAAAATTGATAGAAAGAAAGTTCGGATTGGTTGAGATAATGTAGTAGGTGGTGAAATTAAATAGAAAATTGTTGTGTGGTAGGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 37.90% 0.53% 0.36% NA
All Indica  2759 70.40% 28.30% 0.83% 0.51% NA
All Japonica  1512 44.10% 55.80% 0.07% 0.00% NA
Aus  269 69.10% 30.90% 0.00% 0.00% NA
Indica I  595 62.00% 37.00% 1.01% 0.00% NA
Indica II  465 56.60% 43.40% 0.00% 0.00% NA
Indica III  913 85.20% 14.50% 0.00% 0.33% NA
Indica Intermediate  786 67.70% 28.80% 2.16% 1.40% NA
Temperate Japonica  767 35.20% 64.70% 0.13% 0.00% NA
Tropical Japonica  504 58.70% 41.30% 0.00% 0.00% NA
Japonica Intermediate  241 41.90% 58.10% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 45.80% 1.04% 1.04% NA
Intermediate  90 53.30% 44.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125079888 T -> DEL N N silent_mutation Average:33.711; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N
vg1125079888 T -> C LOC_Os11g41760.1 upstream_gene_variant ; 2862.0bp to feature; MODIFIER silent_mutation Average:33.711; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N
vg1125079888 T -> C LOC_Os11g41760-LOC_Os11g41770 intergenic_region ; MODIFIER silent_mutation Average:33.711; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125079888 8.96E-09 8.08E-13 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 3.12E-10 NA mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 1.07E-10 2.97E-11 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 3.38E-08 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 5.34E-09 5.47E-09 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 2.28E-10 NA mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 1.07E-10 2.56E-11 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 9.88E-06 NA mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 4.09E-09 1.98E-15 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 3.07E-10 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 6.49E-10 2.70E-10 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 7.19E-08 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 2.39E-10 1.44E-11 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 4.96E-07 1.14E-15 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 4.52E-10 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 1.41E-10 3.84E-11 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 1.67E-06 3.41E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 5.00E-09 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 1.85E-10 1.85E-10 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 9.05E-07 9.05E-07 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 2.95E-11 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 5.06E-11 4.02E-11 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 3.39E-08 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 1.84E-09 4.60E-10 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 2.57E-08 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125079888 8.66E-11 8.66E-11 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251