\
| Variant ID: vg1125063819 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25063819 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGACAACTTACAGAGTGTCTTAAGTCAAATGTCTTATAACAGTGGTTTTGTTGTAGTGCGCTCCACTACGGCAGAAGCTGGCCTTTATTAAGTGCAAAT[G/A]
AAATTGGATCACAACTCAACAGATACAACTCTACTTCCACTTCGATGATCTGCTGCTCATGTAGTTCTATATATTGTCTGCACTTTGTAGCTTGAGAGCC
GGCTCTCAAGCTACAAAGTGCAGACAATATATAGAACTACATGAGCAGCAGATCATCGAAGTGGAAGTAGAGTTGTATCTGTTGAGTTGTGATCCAATTT[C/T]
ATTTGCACTTAATAAAGGCCAGCTTCTGCCGTAGTGGAGCGCACTACAACAAAACCACTGTTATAAGACATTTGACTTAAGACACTCTGTAAGTTGTCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.50% | 44.10% | 2.39% | 4.02% | NA |
| All Indica | 2759 | 33.70% | 65.00% | 1.38% | 0.00% | NA |
| All Japonica | 1512 | 73.10% | 13.00% | 1.59% | 12.37% | NA |
| Aus | 269 | 71.00% | 19.30% | 9.29% | 0.37% | NA |
| Indica I | 595 | 8.20% | 91.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 32.30% | 67.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 45.50% | 52.00% | 2.52% | 0.00% | NA |
| Indica Intermediate | 786 | 40.10% | 58.50% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 73.80% | 3.50% | 2.22% | 20.47% | NA |
| Tropical Japonica | 504 | 71.40% | 26.80% | 0.60% | 1.19% | NA |
| Japonica Intermediate | 241 | 74.30% | 14.10% | 1.66% | 9.96% | NA |
| VI/Aromatic | 96 | 74.00% | 3.10% | 21.88% | 1.04% | NA |
| Intermediate | 90 | 48.90% | 44.40% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125063819 | G -> A | LOC_Os11g41740.1 | missense_variant ; p.Ser152Leu; MODERATE | nonsynonymous_codon ; S152L | Average:34.226; most accessible tissue: Zhenshan97 root, score: 64.819 | unknown | unknown | DELETERIOUS | 0.00 |
| vg1125063819 | G -> DEL | LOC_Os11g41740.1 | N | frameshift_variant | Average:34.226; most accessible tissue: Zhenshan97 root, score: 64.819 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125063819 | 1.88E-09 | NA | mr1238 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | 2.37E-07 | 2.28E-08 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | 1.89E-09 | 3.00E-27 | mr1309 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | 1.22E-08 | 4.23E-10 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | 1.63E-06 | 2.48E-16 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | 5.89E-09 | 1.38E-28 | mr1841 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | NA | 4.92E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | NA | 5.45E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | 7.05E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | 9.55E-07 | 9.61E-25 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | 2.55E-07 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125063819 | 4.64E-07 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |