\
| Variant ID: vg1125050424 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25050424 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.29, others allele: 0.00, population size: 41. )
ACTATATCTGGGGTGAGGTTACTTTGCCACACGGCGGCTTACAAGAGGTATATATATGGTGGAACATTTGCTTCTCCGCTACGCTCCGGCCCAAGCCTCC[T/C]
AGCGACAGGCCTCCGCTCACTACAACAAAACCCCCCCAAAGAAGACATTTTATTTGTAATATAGAGACGTTTTGTTTTGTCTCCGCAAACAAGCGAGGCG
CGCCTCGCTTGTTTGCGGAGACAAAACAAAACGTCTCTATATTACAAATAAAATGTCTTCTTTGGGGGGGTTTTGTTGTAGTGAGCGGAGGCCTGTCGCT[A/G]
GGAGGCTTGGGCCGGAGCGTAGCGGAGAAGCAAATGTTCCACCATATATATACCTCTTGTAAGCCGCCGTGTGGCAAAGTAACCTCACCCCAGATATAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 25.10% | 2.12% | 4.63% | NA |
| All Indica | 2759 | 87.60% | 10.70% | 1.59% | 0.07% | NA |
| All Japonica | 1512 | 34.20% | 51.50% | 0.60% | 13.76% | NA |
| Aus | 269 | 77.70% | 12.60% | 8.55% | 1.12% | NA |
| Indica I | 595 | 98.20% | 1.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.00% | 7.30% | 2.52% | 0.11% | NA |
| Indica Intermediate | 786 | 81.00% | 16.30% | 2.54% | 0.13% | NA |
| Temperate Japonica | 767 | 12.80% | 64.00% | 0.65% | 22.56% | NA |
| Tropical Japonica | 504 | 59.70% | 38.10% | 0.40% | 1.79% | NA |
| Japonica Intermediate | 241 | 49.00% | 39.40% | 0.83% | 10.79% | NA |
| VI/Aromatic | 96 | 29.20% | 47.90% | 18.75% | 4.17% | NA |
| Intermediate | 90 | 57.80% | 33.30% | 6.67% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125050424 | T -> DEL | N | N | silent_mutation | Average:39.68; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1125050424 | T -> C | LOC_Os11g41720.1 | downstream_gene_variant ; 889.0bp to feature; MODIFIER | silent_mutation | Average:39.68; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1125050424 | T -> C | LOC_Os11g41710-LOC_Os11g41720 | intergenic_region ; MODIFIER | silent_mutation | Average:39.68; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125050424 | NA | 3.81E-07 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125050424 | NA | 3.62E-06 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125050424 | 5.70E-06 | 1.33E-06 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125050424 | 1.62E-06 | 1.09E-07 | mr1841 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125050424 | 1.88E-08 | 3.44E-11 | mr1900 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125050424 | NA | 7.21E-12 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125050424 | 7.04E-06 | 2.59E-07 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125050424 | 9.29E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125050424 | 9.47E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |