\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125048193:

Variant ID: vg1125048193 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25048193
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.27, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCATATATGTATTCATGTGTGACTAAGTTCTTTAGATCCTGCTAGTGCATCTTGACACACTTTCTAACAGAAATCAAGGGACAAAGATTCAAGTTTGA[T/C]
ATTACAATAGTCTATATACCAATGGCTCTTGCAAATTACACATATGCATGTAATAAGAAGATCAGTAATATGCCTACTTTCCAAGGAAGGCAGAGGCTAG

Reverse complement sequence

CTAGCCTCTGCCTTCCTTGGAAAGTAGGCATATTACTGATCTTCTTATTACATGCATATGTGTAATTTGCAAGAGCCATTGGTATATAGACTATTGTAAT[A/G]
TCAAACTTGAATCTTTGTCCCTTGATTTCTGTTAGAAAGTGTGTCAAGATGCACTAGCAGGATCTAAAGAACTTAGTCACACATGAATACATATATGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 44.80% 0.15% 4.59% NA
All Indica  2759 72.90% 26.80% 0.18% 0.11% NA
All Japonica  1512 13.80% 72.20% 0.13% 13.82% NA
Aus  269 45.70% 53.20% 0.00% 1.12% NA
Indica I  595 94.60% 4.90% 0.50% 0.00% NA
Indica II  465 68.40% 31.40% 0.22% 0.00% NA
Indica III  913 68.80% 31.10% 0.00% 0.11% NA
Indica Intermediate  786 63.90% 35.80% 0.13% 0.25% NA
Temperate Japonica  767 4.00% 72.90% 0.26% 22.82% NA
Tropical Japonica  504 27.00% 71.20% 0.00% 1.79% NA
Japonica Intermediate  241 17.40% 72.20% 0.00% 10.37% NA
VI/Aromatic  96 4.20% 94.80% 0.00% 1.04% NA
Intermediate  90 44.40% 54.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125048193 T -> DEL N N silent_mutation Average:64.846; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N
vg1125048193 T -> C LOC_Os11g41720.1 downstream_gene_variant ; 3120.0bp to feature; MODIFIER silent_mutation Average:64.846; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N
vg1125048193 T -> C LOC_Os11g41710-LOC_Os11g41720 intergenic_region ; MODIFIER silent_mutation Average:64.846; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125048193 5.44E-09 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 NA 1.59E-06 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 5.69E-09 2.29E-28 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 1.10E-06 4.79E-08 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 NA 1.94E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 2.20E-07 1.01E-17 mr1609 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 6.00E-08 5.72E-27 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 NA 5.01E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 2.51E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 4.78E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 2.34E-07 3.55E-27 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 5.78E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048193 1.56E-09 2.83E-21 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251