Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125048126:

Variant ID: vg1125048126 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25048126
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GACCTCCCTCTCCTTGCATACCTACCACACTCCCCATGCATGTATAGAACTAACAGTATAACTATGCAAGCATATATGTATTCATGTGTGACTAAGTTCT[T/C]
TAGATCCTGCTAGTGCATCTTGACACACTTTCTAACAGAAATCAAGGGACAAAGATTCAAGTTTGATATTACAATAGTCTATATACCAATGGCTCTTGCA

Reverse complement sequence

TGCAAGAGCCATTGGTATATAGACTATTGTAATATCAAACTTGAATCTTTGTCCCTTGATTTCTGTTAGAAAGTGTGTCAAGATGCACTAGCAGGATCTA[A/G]
AGAACTTAGTCACACATGAATACATATATGCTTGCATAGTTATACTGTTAGTTCTATACATGCATGGGGAGTGTGGTAGGTATGCAAGGAGAGGGAGGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.20%	24.20%	0.19%	4.42%	NA
All Indica	2759	88.60%	11.30%	0.07%	0.04%	NA
All Japonica	1512	36.00%	50.10%	0.46%	13.43%	NA
Aus	269	98.10%	0.70%	0.00%	1.12%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	80.60%	19.40%	0.00%	0.00%	NA
Indica III	913	90.10%	9.70%	0.00%	0.11%	NA
Indica Intermediate	786	83.50%	16.30%	0.25%	0.00%	NA
Temperate Japonica	767	14.10%	63.10%	0.78%	22.03%	NA
Tropical Japonica	504	61.70%	36.50%	0.00%	1.79%	NA
Japonica Intermediate	241	52.30%	36.90%	0.41%	10.37%	NA
VI/Aromatic	96	53.10%	45.80%	0.00%	1.04%	NA
Intermediate	90	67.80%	31.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125048126	T -> DEL	N	N	silent_mutation	Average:61.309; most accessible tissue: Zhenshan97 young leaf, score: 84.814	N	N	N	N
vg1125048126	T -> C	LOC_Os11g41720.1	downstream_gene_variant ; 3187.0bp to feature; MODIFIER	silent_mutation	Average:61.309; most accessible tissue: Zhenshan97 young leaf, score: 84.814	N	N	N	N
vg1125048126	T -> C	LOC_Os11g41710-LOC_Os11g41720	intergenic_region ; MODIFIER	silent_mutation	Average:61.309; most accessible tissue: Zhenshan97 young leaf, score: 84.814	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125048126	NA	6.57E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048126	NA	2.02E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048126	NA	6.86E-14	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048126	NA	2.42E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048126	NA	2.17E-14	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048126	NA	6.74E-08	mr1906	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048126	NA	3.04E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048126	NA	1.21E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125048126	NA	8.14E-15	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251