| Variant ID: vg1125047295 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25047295 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 69. )
TTTCTATCATTTCGCCAAGCACTCTATTTCGAGTGATTCCACGATCTGGGCTTCAAGATGAGAAAATTGCATATCTACCGTCGCATAAAACTGGCTTCGC[C/T]
AGAATACCATTACTCAAATAGGTTTCACTAGAATACCATCCTCAACCGAGTACAATTTGATACAATGCCATTTTCATCATTTTCGGCTAATAGAAAAGGT
ACCTTTTCTATTAGCCGAAAATGATGAAAATGGCATTGTATCAAATTGTACTCGGTTGAGGATGGTATTCTAGTGAAACCTATTTGAGTAATGGTATTCT[G/A]
GCGAAGCCAGTTTTATGCGACGGTAGATATGCAATTTTCTCATCTTGAAGCCCAGATCGTGGAATCACTCGAAATAGAGTGCTTGGCGAAATGATAGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 4.80% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 84.90% | 14.30% | 0.79% | 0.00% | NA |
| Aus | 269 | 97.80% | 1.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 74.80% | 23.60% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125047295 | C -> T | LOC_Os11g41710.1 | downstream_gene_variant ; 4296.0bp to feature; MODIFIER | silent_mutation | Average:44.159; most accessible tissue: Callus, score: 70.907 | N | N | N | N |
| vg1125047295 | C -> T | LOC_Os11g41720.1 | downstream_gene_variant ; 4018.0bp to feature; MODIFIER | silent_mutation | Average:44.159; most accessible tissue: Callus, score: 70.907 | N | N | N | N |
| vg1125047295 | C -> T | LOC_Os11g41710-LOC_Os11g41720 | intergenic_region ; MODIFIER | silent_mutation | Average:44.159; most accessible tissue: Callus, score: 70.907 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125047295 | 3.11E-08 | 7.54E-09 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125047295 | 3.40E-12 | 2.72E-13 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125047295 | 4.89E-06 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125047295 | 1.16E-06 | 1.01E-07 | mr1300 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125047295 | 1.27E-07 | 3.19E-09 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125047295 | 1.11E-13 | 2.21E-12 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125047295 | 2.23E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125047295 | 9.00E-07 | 6.39E-08 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125047295 | 8.45E-14 | 5.98E-14 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125047295 | 2.85E-06 | 2.85E-06 | mr1498 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/