\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125042652:

Variant ID: vg1125042652 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25042652
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTAGCAAGTCTCTTGTACCATTTCAACTGGGAGCTTCCTGATGAGACGGAGCTTGGGAACCTTGATATGAAGGAGGAGATGGGGGCAATAGCACGACG[G/A]
CTCCATGATCTTTCGCTTGTTCCAGTCATTCGCCATCCATTACCGGTAGATATGTAATAGCTATCAGTCAGTAGCTTGATGATTTACATCTTGGAGGGCT

Reverse complement sequence

AGCCCTCCAAGATGTAAATCATCAAGCTACTGACTGATAGCTATTACATATCTACCGGTAATGGATGGCGAATGACTGGAACAAGCGAAAGATCATGGAG[C/T]
CGTCGTGCTATTGCCCCCATCTCCTCCTTCATATCAAGGTTCCCAAGCTCCGTCTCATCAGGAAGCTCCCAGTTGAAATGGTACAAGAGACTTGCTAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 6.70% 0.23% 4.17% NA
All Indica  2759 96.70% 3.20% 0.00% 0.11% NA
All Japonica  1512 75.90% 10.80% 0.66% 12.57% NA
Aus  269 85.10% 13.80% 0.37% 0.74% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.30% 9.70% 0.00% 0.00% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 94.40% 5.30% 0.00% 0.25% NA
Temperate Japonica  767 73.30% 5.00% 0.91% 20.86% NA
Tropical Japonica  504 77.80% 20.60% 0.20% 1.39% NA
Japonica Intermediate  241 80.50% 9.10% 0.83% 9.54% NA
VI/Aromatic  96 77.10% 21.90% 0.00% 1.04% NA
Intermediate  90 90.00% 8.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125042652 G -> A LOC_Os11g41710.1 synonymous_variant ; p.Arg494Arg; LOW synonymous_codon Average:44.723; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg1125042652 G -> DEL LOC_Os11g41710.1 N frameshift_variant Average:44.723; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125042652 1.22E-23 1.11E-25 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 1.23E-09 6.19E-10 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 1.06E-15 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 NA 7.01E-07 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 3.65E-19 5.39E-21 mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 1.88E-09 1.55E-09 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 NA 4.32E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 NA 3.38E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 1.95E-16 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 9.79E-07 1.07E-06 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 1.01E-10 1.57E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 7.21E-06 1.19E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 8.30E-07 NA mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 3.19E-24 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 5.25E-12 1.80E-12 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 8.61E-22 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 2.67E-10 2.67E-10 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 5.51E-10 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 3.97E-06 3.97E-06 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 1.36E-25 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 1.91E-09 6.90E-10 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 9.38E-18 2.15E-20 mr1900_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 3.00E-08 1.08E-08 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 3.79E-07 NA mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 1.22E-19 3.16E-22 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652 1.11E-10 1.11E-10 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251