Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125042652:

Variant ID: vg1125042652 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25042652
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTAGCAAGTCTCTTGTACCATTTCAACTGGGAGCTTCCTGATGAGACGGAGCTTGGGAACCTTGATATGAAGGAGGAGATGGGGGCAATAGCACGACG[G/A]
CTCCATGATCTTTCGCTTGTTCCAGTCATTCGCCATCCATTACCGGTAGATATGTAATAGCTATCAGTCAGTAGCTTGATGATTTACATCTTGGAGGGCT

Reverse complement sequence

AGCCCTCCAAGATGTAAATCATCAAGCTACTGACTGATAGCTATTACATATCTACCGGTAATGGATGGCGAATGACTGGAACAAGCGAAAGATCATGGAG[C/T]
CGTCGTGCTATTGCCCCCATCTCCTCCTTCATATCAAGGTTCCCAAGCTCCGTCTCATCAGGAAGCTCCCAGTTGAAATGGTACAAGAGACTTGCTAGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	6.70%	0.23%	4.17%	NA
All Indica	2759	96.70%	3.20%	0.00%	0.11%	NA
All Japonica	1512	75.90%	10.80%	0.66%	12.57%	NA
Aus	269	85.10%	13.80%	0.37%	0.74%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	90.30%	9.70%	0.00%	0.00%	NA
Indica III	913	99.70%	0.20%	0.00%	0.11%	NA
Indica Intermediate	786	94.40%	5.30%	0.00%	0.25%	NA
Temperate Japonica	767	73.30%	5.00%	0.91%	20.86%	NA
Tropical Japonica	504	77.80%	20.60%	0.20%	1.39%	NA
Japonica Intermediate	241	80.50%	9.10%	0.83%	9.54%	NA
VI/Aromatic	96	77.10%	21.90%	0.00%	1.04%	NA
Intermediate	90	90.00%	8.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125042652	G -> A	LOC_Os11g41710.1	synonymous_variant ; p.Arg494Arg; LOW	synonymous_codon	Average:44.723; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg1125042652	G -> DEL	LOC_Os11g41710.1	N	frameshift_variant	Average:44.723; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125042652	1.22E-23	1.11E-25	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	1.23E-09	6.19E-10	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	1.06E-15	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	NA	7.01E-07	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	3.65E-19	5.39E-21	mr1484	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	1.88E-09	1.55E-09	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	NA	4.32E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	NA	3.38E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	1.95E-16	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	9.79E-07	1.07E-06	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	1.01E-10	1.57E-14	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	7.21E-06	1.19E-07	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	8.30E-07	NA	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	3.19E-24	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	5.25E-12	1.80E-12	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	8.61E-22	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	2.67E-10	2.67E-10	mr1484_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	5.51E-10	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	3.97E-06	3.97E-06	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	1.36E-25	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	1.91E-09	6.90E-10	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	9.38E-18	2.15E-20	mr1900_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	3.00E-08	1.08E-08	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	3.79E-07	NA	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	1.22E-19	3.16E-22	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042652	1.11E-10	1.11E-10	mr1945_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251