\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125042488:

Variant ID: vg1125042488 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25042488
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTAGGGACCCTATGTACTGGGACCAAGCAGAAGAGTTCATCCCAGAGAGATTCGAGCATGTCAACATTGATTACTATGGAACCGATGTCAAGTACATG[C/T]
CGTTCGGAGTAGGTCGACGGATATGTCCTGGAATAGCTTTTGGTCTAGTGAACTTGGAGCTTGTGCTAGCAAGTCTCTTGTACCATTTCAACTGGGAGCT

Reverse complement sequence

AGCTCCCAGTTGAAATGGTACAAGAGACTTGCTAGCACAAGCTCCAAGTTCACTAGACCAAAAGCTATTCCAGGACATATCCGTCGACCTACTCCGAACG[G/A]
CATGTACTTGACATCGGTTCCATAGTAATCAATGTTGACATGCTCGAATCTCTCTGGGATGAACTCTTCTGCTTGGTCCCAGTACATAGGGTCCCTACTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 1.30% 1.10% 4.10% NA
All Indica  2759 99.80% 0.00% 0.11% 0.07% NA
All Japonica  1512 80.40% 4.10% 3.04% 12.50% NA
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 99.40% 0.10% 0.38% 0.13% NA
Temperate Japonica  767 72.40% 2.60% 4.43% 20.60% NA
Tropical Japonica  504 96.00% 1.40% 1.19% 1.39% NA
Japonica Intermediate  241 73.00% 14.50% 2.49% 9.96% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 96.70% 0.00% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125042488 C -> T LOC_Os11g41710.1 missense_variant ; p.Pro440Ser; MODERATE nonsynonymous_codon ; P440S Average:54.351; most accessible tissue: Zhenshan97 panicle, score: 67.02 probably damaging 2.237 DELETERIOUS 0.00
vg1125042488 C -> DEL LOC_Os11g41710.1 N frameshift_variant Average:54.351; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125042488 NA 2.53E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488 NA 9.23E-07 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488 1.61E-06 1.61E-06 mr1329_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488 8.45E-06 1.60E-06 mr1331_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488 5.04E-06 5.04E-06 mr1337_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488 NA 5.54E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488 2.75E-07 4.01E-08 mr1444_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488 9.14E-06 9.14E-06 mr1674_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488 9.85E-06 9.85E-06 mr1688_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488 3.29E-06 3.29E-06 mr1697_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488 2.06E-06 2.06E-06 mr1982_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251