Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125042488:

Variant ID: vg1125042488 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25042488
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGTAGGGACCCTATGTACTGGGACCAAGCAGAAGAGTTCATCCCAGAGAGATTCGAGCATGTCAACATTGATTACTATGGAACCGATGTCAAGTACATG[C/T]
CGTTCGGAGTAGGTCGACGGATATGTCCTGGAATAGCTTTTGGTCTAGTGAACTTGGAGCTTGTGCTAGCAAGTCTCTTGTACCATTTCAACTGGGAGCT

Reverse complement sequence

AGCTCCCAGTTGAAATGGTACAAGAGACTTGCTAGCACAAGCTCCAAGTTCACTAGACCAAAAGCTATTCCAGGACATATCCGTCGACCTACTCCGAACG[G/A]
CATGTACTTGACATCGGTTCCATAGTAATCAATGTTGACATGCTCGAATCTCTCTGGGATGAACTCTTCTGCTTGGTCCCAGTACATAGGGTCCCTACTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	1.30%	1.10%	4.10%	NA
All Indica	2759	99.80%	0.00%	0.11%	0.07%	NA
All Japonica	1512	80.40%	4.10%	3.04%	12.50%	NA
Aus	269	99.30%	0.00%	0.37%	0.37%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	99.40%	0.10%	0.38%	0.13%	NA
Temperate Japonica	767	72.40%	2.60%	4.43%	20.60%	NA
Tropical Japonica	504	96.00%	1.40%	1.19%	1.39%	NA
Japonica Intermediate	241	73.00%	14.50%	2.49%	9.96%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	96.70%	0.00%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125042488	C -> T	LOC_Os11g41710.1	missense_variant ; p.Pro440Ser; MODERATE	nonsynonymous_codon ; P440S	Average:54.351; most accessible tissue: Zhenshan97 panicle, score: 67.02	probably damaging	2.237	DELETERIOUS	0.00
vg1125042488	C -> DEL	LOC_Os11g41710.1	N	frameshift_variant	Average:54.351; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125042488	NA	2.53E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488	NA	9.23E-07	mr1267_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488	1.61E-06	1.61E-06	mr1329_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488	8.45E-06	1.60E-06	mr1331_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488	5.04E-06	5.04E-06	mr1337_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488	NA	5.54E-06	mr1417_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488	2.75E-07	4.01E-08	mr1444_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488	9.14E-06	9.14E-06	mr1674_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488	9.85E-06	9.85E-06	mr1688_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488	3.29E-06	3.29E-06	mr1697_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125042488	2.06E-06	2.06E-06	mr1982_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251