\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125038879:

Variant ID: vg1125038879 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25038879
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, G: 0.36, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAACGGCGTAAAATGTTTAGGGTTGGAGGGAGTATTTGTCAAGCAGTTGAGATTTCTCTGTTGTTTATCAGACACTATTTTAGTACTAGATCAATATG[T/G]
ATCAACAACTCACATTTATGTATTTCTTTAATTATCTCGTGGTGAAGGAGCGAAGGTTCTGTCCTAAAATTTTGAAAAGTGTATTGGCATAAATTCTTAT

Reverse complement sequence

ATAAGAATTTATGCCAATACACTTTTCAAAATTTTAGGACAGAACCTTCGCTCCTTCACCACGAGATAATTAAAGAAATACATAAATGTGAGTTGTTGAT[A/C]
CATATTGATCTAGTACTAAAATAGTGTCTGATAAACAACAGAGAAATCTCAACTGCTTGACAAATACTCCCTCCAACCCTAAACATTTTACGCCGTTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 29.80% 0.19% 4.68% NA
All Indica  2759 83.40% 16.30% 0.18% 0.11% NA
All Japonica  1512 34.50% 51.20% 0.20% 14.09% NA
Aus  269 69.10% 29.40% 0.37% 1.12% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 69.70% 29.90% 0.43% 0.00% NA
Indica III  913 89.40% 10.40% 0.11% 0.11% NA
Indica Intermediate  786 73.50% 26.00% 0.25% 0.25% NA
Temperate Japonica  767 13.20% 63.20% 0.39% 23.21% NA
Tropical Japonica  504 59.90% 38.30% 0.00% 1.79% NA
Japonica Intermediate  241 49.40% 39.80% 0.00% 10.79% NA
VI/Aromatic  96 29.20% 69.80% 0.00% 1.04% NA
Intermediate  90 57.80% 41.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125038879 T -> DEL N N silent_mutation Average:35.016; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1125038879 T -> G LOC_Os11g41700.1 upstream_gene_variant ; 2905.0bp to feature; MODIFIER silent_mutation Average:35.016; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1125038879 T -> G LOC_Os11g41710.1 upstream_gene_variant ; 1997.0bp to feature; MODIFIER silent_mutation Average:35.016; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg1125038879 T -> G LOC_Os11g41700-LOC_Os11g41710 intergenic_region ; MODIFIER silent_mutation Average:35.016; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125038879 2.08E-09 1.04E-09 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 5.41E-12 5.54E-13 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 8.57E-06 8.41E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 9.66E-09 5.06E-10 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 1.18E-13 2.07E-12 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 3.24E-06 2.73E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 9.96E-13 4.21E-13 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 NA 1.24E-08 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 1.83E-06 1.83E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 2.89E-07 2.91E-08 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 7.09E-13 1.41E-13 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 8.80E-16 2.07E-17 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 6.60E-08 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 1.64E-06 2.24E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 8.10E-06 8.10E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 2.92E-06 NA mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 3.01E-09 3.90E-10 mr1959 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 4.66E-06 7.58E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 4.03E-12 6.28E-12 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 3.19E-07 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 1.30E-06 1.21E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 NA 9.86E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 4.44E-11 4.44E-11 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 4.67E-06 3.01E-09 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 1.25E-09 1.25E-09 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 7.88E-07 6.53E-07 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 9.04E-13 3.28E-12 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 4.10E-07 5.31E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 3.59E-11 8.87E-12 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 5.45E-06 5.45E-06 mr1925_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 1.04E-09 1.04E-09 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038879 7.35E-06 2.20E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251