| Variant ID: vg1125038879 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25038879 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, G: 0.36, others allele: 0.00, population size: 89. )
GTCAACGGCGTAAAATGTTTAGGGTTGGAGGGAGTATTTGTCAAGCAGTTGAGATTTCTCTGTTGTTTATCAGACACTATTTTAGTACTAGATCAATATG[T/G]
ATCAACAACTCACATTTATGTATTTCTTTAATTATCTCGTGGTGAAGGAGCGAAGGTTCTGTCCTAAAATTTTGAAAAGTGTATTGGCATAAATTCTTAT
ATAAGAATTTATGCCAATACACTTTTCAAAATTTTAGGACAGAACCTTCGCTCCTTCACCACGAGATAATTAAAGAAATACATAAATGTGAGTTGTTGAT[A/C]
CATATTGATCTAGTACTAAAATAGTGTCTGATAAACAACAGAGAAATCTCAACTGCTTGACAAATACTCCCTCCAACCCTAAACATTTTACGCCGTTGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.40% | 29.80% | 0.19% | 4.68% | NA |
| All Indica | 2759 | 83.40% | 16.30% | 0.18% | 0.11% | NA |
| All Japonica | 1512 | 34.50% | 51.20% | 0.20% | 14.09% | NA |
| Aus | 269 | 69.10% | 29.40% | 0.37% | 1.12% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 69.70% | 29.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 89.40% | 10.40% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 73.50% | 26.00% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 13.20% | 63.20% | 0.39% | 23.21% | NA |
| Tropical Japonica | 504 | 59.90% | 38.30% | 0.00% | 1.79% | NA |
| Japonica Intermediate | 241 | 49.40% | 39.80% | 0.00% | 10.79% | NA |
| VI/Aromatic | 96 | 29.20% | 69.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 57.80% | 41.10% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125038879 | T -> DEL | N | N | silent_mutation | Average:35.016; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg1125038879 | T -> G | LOC_Os11g41700.1 | upstream_gene_variant ; 2905.0bp to feature; MODIFIER | silent_mutation | Average:35.016; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg1125038879 | T -> G | LOC_Os11g41710.1 | upstream_gene_variant ; 1997.0bp to feature; MODIFIER | silent_mutation | Average:35.016; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg1125038879 | T -> G | LOC_Os11g41700-LOC_Os11g41710 | intergenic_region ; MODIFIER | silent_mutation | Average:35.016; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125038879 | 2.08E-09 | 1.04E-09 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125038879 | 5.41E-12 | 5.54E-13 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125038879 | 8.57E-06 | 8.41E-07 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125038879 | 9.66E-09 | 5.06E-10 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125038879 | 1.18E-13 | 2.07E-12 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125038879 | 3.24E-06 | 2.73E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125038879 | 9.96E-13 | 4.21E-13 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125038879 | NA | 1.24E-08 | mr1609 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125038879 | 1.83E-06 | 1.83E-06 | mr1609 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125038879 | 2.89E-07 | 2.91E-08 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/