\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125038779:

Variant ID: vg1125038779 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25038779
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTATACATAAAAATATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAATTTTTTTAATAAGACAGTCAGACATATTTAGAAAA[G/A]
TCAACGGCGTAAAATGTTTAGGGTTGGAGGGAGTATTTGTCAAGCAGTTGAGATTTCTCTGTTGTTTATCAGACACTATTTTAGTACTAGATCAATATGT

Reverse complement sequence

ACATATTGATCTAGTACTAAAATAGTGTCTGATAAACAACAGAGAAATCTCAACTGCTTGACAAATACTCCCTCCAACCCTAAACATTTTACGCCGTTGA[C/T]
TTTTCTAAATATGTCTGACTGTCTTATTAAAAAAATTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATATTTTTATGTATACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 16.70% 0.13% 4.63% NA
All Indica  2759 76.90% 22.90% 0.11% 0.07% NA
All Japonica  1512 79.90% 5.90% 0.20% 14.02% NA
Aus  269 80.70% 18.20% 0.00% 1.12% NA
Indica I  595 65.00% 35.00% 0.00% 0.00% NA
Indica II  465 73.30% 26.50% 0.22% 0.00% NA
Indica III  913 81.40% 18.40% 0.11% 0.11% NA
Indica Intermediate  786 82.70% 17.00% 0.13% 0.13% NA
Temperate Japonica  767 68.60% 8.10% 0.26% 23.08% NA
Tropical Japonica  504 96.20% 2.00% 0.00% 1.79% NA
Japonica Intermediate  241 81.70% 7.10% 0.41% 10.79% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 81.10% 17.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125038779 G -> A LOC_Os11g41700.1 upstream_gene_variant ; 2805.0bp to feature; MODIFIER silent_mutation Average:40.588; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N
vg1125038779 G -> A LOC_Os11g41710.1 upstream_gene_variant ; 2097.0bp to feature; MODIFIER silent_mutation Average:40.588; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N
vg1125038779 G -> A LOC_Os11g41700-LOC_Os11g41710 intergenic_region ; MODIFIER silent_mutation Average:40.588; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N
vg1125038779 G -> DEL N N silent_mutation Average:40.588; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125038779 NA 7.13E-10 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 3.39E-08 NA mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 6.70E-06 NA mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 7.24E-08 5.68E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 1.97E-06 7.17E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 9.87E-07 NA mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 3.05E-06 NA mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 NA 2.19E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 NA 6.85E-16 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 1.10E-06 NA mr1238_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 6.00E-06 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 2.82E-08 9.37E-06 mr1841_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 7.01E-08 NA mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 NA 5.92E-08 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038779 NA 2.81E-09 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251