Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125038758:

Variant ID: vg1125038758 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25038758
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTGAAATATGTAAAACTATATGTATACATAAAAATATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAATTTTTTTAATAAGA[C/T]
AGTCAGACATATTTAGAAAAGTCAACGGCGTAAAATGTTTAGGGTTGGAGGGAGTATTTGTCAAGCAGTTGAGATTTCTCTGTTGTTTATCAGACACTAT

Reverse complement sequence

ATAGTGTCTGATAAACAACAGAGAAATCTCAACTGCTTGACAAATACTCCCTCCAACCCTAAACATTTTACGCCGTTGACTTTTCTAAATATGTCTGACT[G/A]
TCTTATTAAAAAAATTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATATTTTTATGTATACATATAGTTTTACATATTTCACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	26.50%	0.23%	4.53%	NA
All Indica	2759	61.70%	38.10%	0.18%	0.11%	NA
All Japonica	1512	81.20%	4.80%	0.40%	13.62%	NA
Aus	269	56.50%	42.40%	0.00%	1.12%	NA
Indica I	595	59.70%	39.70%	0.67%	0.00%	NA
Indica II	465	71.20%	28.60%	0.22%	0.00%	NA
Indica III	913	50.20%	49.70%	0.00%	0.11%	NA
Indica Intermediate	786	70.90%	28.90%	0.00%	0.25%	NA
Temperate Japonica	767	73.50%	3.40%	0.65%	22.43%	NA
Tropical Japonica	504	93.10%	5.20%	0.00%	1.79%	NA
Japonica Intermediate	241	80.90%	8.30%	0.41%	10.37%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	83.30%	15.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125038758	C -> T	LOC_Os11g41700.1	upstream_gene_variant ; 2784.0bp to feature; MODIFIER	silent_mutation	Average:41.723; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N
vg1125038758	C -> T	LOC_Os11g41710.1	upstream_gene_variant ; 2118.0bp to feature; MODIFIER	silent_mutation	Average:41.723; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N
vg1125038758	C -> T	LOC_Os11g41700-LOC_Os11g41710	intergenic_region ; MODIFIER	silent_mutation	Average:41.723; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N
vg1125038758	C -> DEL	N	N	silent_mutation	Average:41.723; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125038758	8.05E-06	2.59E-17	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	NA	2.88E-11	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	8.78E-07	1.88E-19	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	3.00E-06	7.08E-14	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	1.50E-06	NA	mr1900	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	4.79E-06	4.79E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	NA	1.98E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	1.74E-09	1.93E-29	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	4.15E-09	1.28E-20	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	NA	3.51E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	NA	3.92E-06	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	3.04E-07	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	NA	1.67E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	3.05E-07	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	NA	8.30E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	NA	2.29E-07	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758	NA	1.96E-09	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251