\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125038758:

Variant ID: vg1125038758 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25038758
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTGAAATATGTAAAACTATATGTATACATAAAAATATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAATTTTTTTAATAAGA[C/T]
AGTCAGACATATTTAGAAAAGTCAACGGCGTAAAATGTTTAGGGTTGGAGGGAGTATTTGTCAAGCAGTTGAGATTTCTCTGTTGTTTATCAGACACTAT

Reverse complement sequence

ATAGTGTCTGATAAACAACAGAGAAATCTCAACTGCTTGACAAATACTCCCTCCAACCCTAAACATTTTACGCCGTTGACTTTTCTAAATATGTCTGACT[G/A]
TCTTATTAAAAAAATTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATATTTTTATGTATACATATAGTTTTACATATTTCACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 26.50% 0.23% 4.53% NA
All Indica  2759 61.70% 38.10% 0.18% 0.11% NA
All Japonica  1512 81.20% 4.80% 0.40% 13.62% NA
Aus  269 56.50% 42.40% 0.00% 1.12% NA
Indica I  595 59.70% 39.70% 0.67% 0.00% NA
Indica II  465 71.20% 28.60% 0.22% 0.00% NA
Indica III  913 50.20% 49.70% 0.00% 0.11% NA
Indica Intermediate  786 70.90% 28.90% 0.00% 0.25% NA
Temperate Japonica  767 73.50% 3.40% 0.65% 22.43% NA
Tropical Japonica  504 93.10% 5.20% 0.00% 1.79% NA
Japonica Intermediate  241 80.90% 8.30% 0.41% 10.37% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 83.30% 15.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125038758 C -> T LOC_Os11g41700.1 upstream_gene_variant ; 2784.0bp to feature; MODIFIER silent_mutation Average:41.723; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1125038758 C -> T LOC_Os11g41710.1 upstream_gene_variant ; 2118.0bp to feature; MODIFIER silent_mutation Average:41.723; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1125038758 C -> T LOC_Os11g41700-LOC_Os11g41710 intergenic_region ; MODIFIER silent_mutation Average:41.723; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1125038758 C -> DEL N N silent_mutation Average:41.723; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125038758 8.05E-06 2.59E-17 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 NA 2.88E-11 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 8.78E-07 1.88E-19 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 3.00E-06 7.08E-14 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 1.50E-06 NA mr1900 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 4.79E-06 4.79E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 NA 1.98E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 1.74E-09 1.93E-29 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 4.15E-09 1.28E-20 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 NA 3.51E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 NA 3.92E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 3.04E-07 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 NA 1.67E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 3.05E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 NA 8.30E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 NA 2.29E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038758 NA 1.96E-09 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251