Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125038483:

Variant ID: vg1125038483 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25038483
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGTCTACGTTTAATATTTATAATTAATTTTCAAACATCCGATGTGATAGGGACTTAAAAGTTTTAGTCCCATCTAAACAGGGCCTAATTATTCATCTT[A/T]
GGAATCACAACGTCAACTCATCGTACTGAATTCATGAAAATGATCCTGACAGATCATACACGATTGTACATGCATAACGTTATCATTTGAGACTATCTAC

Reverse complement sequence

GTAGATAGTCTCAAATGATAACGTTATGCATGTACAATCGTGTATGATCTGTCAGGATCATTTTCATGAATTCAGTACGATGAGTTGACGTTGTGATTCC[T/A]
AAGATGAATAATTAGGCCCTGTTTAGATGGGACTAAAACTTTTAAGTCCCTATCACATCGGATGTTTGAAAATTAATTATAAATATTAAACGTAGACTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	2.00%	0.19%	4.34%	NA
All Indica	2759	99.80%	0.10%	0.00%	0.11%	NA
All Japonica	1512	82.40%	3.90%	0.60%	13.10%	NA
Aus	269	88.80%	10.40%	0.00%	0.74%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	99.50%	0.30%	0.00%	0.25%	NA
Temperate Japonica	767	72.40%	5.10%	0.91%	21.64%	NA
Tropical Japonica	504	95.80%	2.40%	0.20%	1.59%	NA
Japonica Intermediate	241	86.30%	3.30%	0.41%	9.96%	NA
VI/Aromatic	96	96.90%	2.10%	0.00%	1.04%	NA
Intermediate	90	95.60%	3.30%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125038483	A -> T	LOC_Os11g41700.1	upstream_gene_variant ; 2509.0bp to feature; MODIFIER	silent_mutation	Average:30.214; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N
vg1125038483	A -> T	LOC_Os11g41710.1	upstream_gene_variant ; 2393.0bp to feature; MODIFIER	silent_mutation	Average:30.214; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N
vg1125038483	A -> T	LOC_Os11g41700-LOC_Os11g41710	intergenic_region ; MODIFIER	silent_mutation	Average:30.214; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N
vg1125038483	A -> DEL	N	N	silent_mutation	Average:30.214; most accessible tissue: Minghui63 young leaf, score: 53.016	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125038483	3.40E-07	2.98E-06	mr1695_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038483	4.95E-06	3.57E-07	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251