\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125038070:

Variant ID: vg1125038070 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25038070
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGCACCATAGTCTTTCTTCTTAAACCTTAATATATGCTAAACAACATATAATTGCAATTATTTTGGGACGGAGGTAGTATTCTTTATGTGATGTAGAT[C/T]
GATCAGATCAATAATTGAGACTGCCGGATGCATGGCTGATCAATCATCGCACGCGCTAAATTAAGGTGGTGTTTACTTCCAGGGACTTAACTTTAGTCCC

Reverse complement sequence

GGGACTAAAGTTAAGTCCCTGGAAGTAAACACCACCTTAATTTAGCGCGTGCGATGATTGATCAGCCATGCATCCGGCAGTCTCAATTATTGATCTGATC[G/A]
ATCTACATCACATAAAGAATACTACCTCCGTCCCAAAATAATTGCAATTATATGTTGTTTAGCATATATTAAGGTTTAAGAAGAAAGACTATGGTGCCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 5.60% 0.17% 15.55% NA
All Indica  2759 82.30% 4.70% 0.18% 12.83% NA
All Japonica  1512 74.70% 0.50% 0.20% 24.60% NA
Aus  269 72.90% 26.40% 0.00% 0.74% NA
Indica I  595 70.60% 0.00% 0.17% 29.24% NA
Indica II  465 86.90% 10.10% 0.22% 2.80% NA
Indica III  913 85.80% 2.70% 0.11% 11.39% NA
Indica Intermediate  786 84.50% 7.30% 0.25% 8.02% NA
Temperate Japonica  767 76.40% 0.50% 0.26% 22.82% NA
Tropical Japonica  504 70.40% 0.00% 0.20% 29.37% NA
Japonica Intermediate  241 78.00% 1.70% 0.00% 20.33% NA
VI/Aromatic  96 53.10% 45.80% 0.00% 1.04% NA
Intermediate  90 81.10% 12.20% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125038070 C -> T LOC_Os11g41700.1 upstream_gene_variant ; 2096.0bp to feature; MODIFIER silent_mutation Average:35.936; most accessible tissue: Minghui63 young leaf, score: 81.798 N N N N
vg1125038070 C -> T LOC_Os11g41710.1 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:35.936; most accessible tissue: Minghui63 young leaf, score: 81.798 N N N N
vg1125038070 C -> T LOC_Os11g41690.1 downstream_gene_variant ; 4735.0bp to feature; MODIFIER silent_mutation Average:35.936; most accessible tissue: Minghui63 young leaf, score: 81.798 N N N N
vg1125038070 C -> T LOC_Os11g41700-LOC_Os11g41710 intergenic_region ; MODIFIER silent_mutation Average:35.936; most accessible tissue: Minghui63 young leaf, score: 81.798 N N N N
vg1125038070 C -> DEL N N silent_mutation Average:35.936; most accessible tissue: Minghui63 young leaf, score: 81.798 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125038070 C T 0.06 0.08 0.03 -0.01 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125038070 7.83E-09 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038070 3.44E-09 NA mr1309 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038070 2.25E-06 NA mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038070 5.41E-10 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038070 6.24E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038070 3.73E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038070 1.91E-07 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038070 1.02E-10 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125038070 5.16E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251