\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125037808:

Variant ID: vg1125037808 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25037808
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, C: 0.35, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCGTAATATGTAATGATAAGACAAAATAGATTCTTATGCCCTCTCTCTACGGTCAATGTGGTTCGTTCAATTTCAAGTTTTGTTGATAGTATAATATA[G/C]
TACCTCCGTCCTAAAATAATTGTATTTCTAGGATTCAAAAATCGTCCCAAAATAATTGTAATTCTAGAGTACTAATTGCCCCATCAATCATATCTCATTC

Reverse complement sequence

GAATGAGATATGATTGATGGGGCAATTAGTACTCTAGAATTACAATTATTTTGGGACGATTTTTGAATCCTAGAAATACAATTATTTTAGGACGGAGGTA[C/G]
TATATTATACTATCAACAAAACTTGAAATTGAACGAACCACATTGACCGTAGAGAGAGGGCATAAGAATCTATTTTGTCTTATCATTACATATTACGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 5.60% 0.19% 4.53% NA
All Indica  2759 96.30% 3.60% 0.00% 0.11% NA
All Japonica  1512 81.80% 4.00% 0.46% 13.69% NA
Aus  269 71.00% 27.50% 0.74% 0.74% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 93.30% 6.50% 0.00% 0.25% NA
Temperate Japonica  767 71.20% 5.50% 0.91% 22.43% NA
Tropical Japonica  504 96.20% 2.00% 0.00% 1.79% NA
Japonica Intermediate  241 85.50% 3.70% 0.00% 10.79% NA
VI/Aromatic  96 75.00% 24.00% 0.00% 1.04% NA
Intermediate  90 88.90% 10.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125037808 G -> DEL N N silent_mutation Average:49.801; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg1125037808 G -> C LOC_Os11g41700.1 upstream_gene_variant ; 1834.0bp to feature; MODIFIER silent_mutation Average:49.801; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg1125037808 G -> C LOC_Os11g41710.1 upstream_gene_variant ; 3068.0bp to feature; MODIFIER silent_mutation Average:49.801; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg1125037808 G -> C LOC_Os11g41690.1 downstream_gene_variant ; 4473.0bp to feature; MODIFIER silent_mutation Average:49.801; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg1125037808 G -> C LOC_Os11g41700-LOC_Os11g41710 intergenic_region ; MODIFIER silent_mutation Average:49.801; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125037808 2.29E-20 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 2.18E-10 9.21E-07 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 9.16E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 1.03E-06 NA mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 3.13E-16 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 4.25E-09 6.45E-06 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 5.63E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 8.95E-06 NA mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 4.03E-15 3.48E-17 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 7.21E-10 2.89E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 2.58E-08 NA mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 5.51E-16 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 1.89E-09 3.62E-07 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 1.18E-12 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 1.68E-09 NA mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 1.82E-06 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 8.44E-07 NA mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 8.10E-18 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 1.52E-09 3.03E-06 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 4.38E-09 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 3.67E-08 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 2.10E-17 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 1.42E-06 1.42E-06 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 3.71E-12 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 5.33E-23 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 1.80E-11 1.48E-07 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 1.51E-18 NA mr1900_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 5.36E-11 1.99E-07 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 5.30E-15 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 4.88E-06 4.88E-06 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037808 7.94E-06 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251