Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125037120:

Variant ID: vg1125037120 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25037120
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTACTCCGCATTCCATGGCCTTGGAACCCGTCGTAAACATGTGACATAACCCTTCACCCATCCTAGCCGTGAACAAAAGTACCGACCCAACCCTGCCTA[C/T]
GGCCGGTATCCCGGGACAGGCAGGCCAGGATTGAGCCCCAAGCAACAGGATCTAGACCGGGTGCGCCACACACATAGGGGTGAGACCACCCGCGTACTAG

Reverse complement sequence

CTAGTACGCGGGTGGTCTCACCCCTATGTGTGTGGCGCACCCGGTCTAGATCCTGTTGCTTGGGGCTCAATCCTGGCCTGCCTGTCCCGGGATACCGGCC[G/A]
TAGGCAGGGTTGGGTCGGTACTTTTGTTCACGGCTAGGATGGGTGAAGGGTTATGTCACATGTTTACGACGGGTTCCAAGGCCATGGAATGCGGAGTAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	4.50%	4.46%	0.53%	NA
All Indica	2759	96.60%	0.10%	3.01%	0.29%	NA
All Japonica	1512	83.50%	13.60%	2.71%	0.20%	NA
Aus	269	73.20%	0.70%	25.28%	0.74%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	90.80%	0.00%	8.39%	0.86%	NA
Indica III	913	99.70%	0.10%	0.22%	0.00%	NA
Indica Intermediate	786	94.00%	0.30%	5.22%	0.51%	NA
Temperate Japonica	767	72.40%	22.60%	4.82%	0.26%	NA
Tropical Japonica	504	98.00%	1.80%	0.20%	0.00%	NA
Japonica Intermediate	241	88.40%	10.00%	1.24%	0.41%	NA
VI/Aromatic	96	76.00%	1.00%	10.42%	12.50%	NA
Intermediate	90	88.90%	1.10%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125037120	C -> T	LOC_Os11g41700.1	upstream_gene_variant ; 1146.0bp to feature; MODIFIER	silent_mutation	Average:56.433; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N
vg1125037120	C -> T	LOC_Os11g41710.1	upstream_gene_variant ; 3756.0bp to feature; MODIFIER	silent_mutation	Average:56.433; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N
vg1125037120	C -> T	LOC_Os11g41690.1	downstream_gene_variant ; 3785.0bp to feature; MODIFIER	silent_mutation	Average:56.433; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N
vg1125037120	C -> T	LOC_Os11g41700-LOC_Os11g41710	intergenic_region ; MODIFIER	silent_mutation	Average:56.433; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N
vg1125037120	C -> DEL	N	N	silent_mutation	Average:56.433; most accessible tissue: Zhenshan97 flag leaf, score: 76.356	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125037120	2.57E-22	1.49E-26	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	3.40E-13	1.66E-08	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	4.13E-12	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	5.43E-08	NA	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	5.20E-18	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	1.37E-13	2.22E-08	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	3.87E-14	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	6.86E-08	NA	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	2.10E-17	2.49E-21	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	5.72E-12	1.29E-08	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	2.40E-08	NA	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	6.76E-17	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	4.52E-12	3.11E-09	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	5.86E-16	4.71E-16	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	1.90E-13	1.56E-07	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	9.88E-17	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	9.18E-09	NA	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	6.24E-07	1.42E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	4.70E-06	4.70E-06	mr1945	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	3.00E-10	NA	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	1.01E-07	NA	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	1.54E-23	3.45E-29	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	4.97E-14	2.76E-09	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	3.70E-19	NA	mr1310_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	7.16E-11	NA	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	2.82E-25	3.83E-31	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	3.63E-10	3.63E-10	mr1484_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	3.84E-13	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	1.28E-06	1.28E-06	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	1.97E-24	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	1.08E-15	2.73E-10	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	7.40E-22	1.69E-25	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	1.27E-14	3.74E-10	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	2.95E-20	4.61E-25	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	3.56E-09	3.56E-09	mr1945_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	1.25E-12	NA	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120	3.56E-09	NA	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251