\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125037120:

Variant ID: vg1125037120 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25037120
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTACTCCGCATTCCATGGCCTTGGAACCCGTCGTAAACATGTGACATAACCCTTCACCCATCCTAGCCGTGAACAAAAGTACCGACCCAACCCTGCCTA[C/T]
GGCCGGTATCCCGGGACAGGCAGGCCAGGATTGAGCCCCAAGCAACAGGATCTAGACCGGGTGCGCCACACACATAGGGGTGAGACCACCCGCGTACTAG

Reverse complement sequence

CTAGTACGCGGGTGGTCTCACCCCTATGTGTGTGGCGCACCCGGTCTAGATCCTGTTGCTTGGGGCTCAATCCTGGCCTGCCTGTCCCGGGATACCGGCC[G/A]
TAGGCAGGGTTGGGTCGGTACTTTTGTTCACGGCTAGGATGGGTGAAGGGTTATGTCACATGTTTACGACGGGTTCCAAGGCCATGGAATGCGGAGTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 4.50% 4.46% 0.53% NA
All Indica  2759 96.60% 0.10% 3.01% 0.29% NA
All Japonica  1512 83.50% 13.60% 2.71% 0.20% NA
Aus  269 73.20% 0.70% 25.28% 0.74% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 90.80% 0.00% 8.39% 0.86% NA
Indica III  913 99.70% 0.10% 0.22% 0.00% NA
Indica Intermediate  786 94.00% 0.30% 5.22% 0.51% NA
Temperate Japonica  767 72.40% 22.60% 4.82% 0.26% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 88.40% 10.00% 1.24% 0.41% NA
VI/Aromatic  96 76.00% 1.00% 10.42% 12.50% NA
Intermediate  90 88.90% 1.10% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125037120 C -> T LOC_Os11g41700.1 upstream_gene_variant ; 1146.0bp to feature; MODIFIER silent_mutation Average:56.433; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg1125037120 C -> T LOC_Os11g41710.1 upstream_gene_variant ; 3756.0bp to feature; MODIFIER silent_mutation Average:56.433; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg1125037120 C -> T LOC_Os11g41690.1 downstream_gene_variant ; 3785.0bp to feature; MODIFIER silent_mutation Average:56.433; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg1125037120 C -> T LOC_Os11g41700-LOC_Os11g41710 intergenic_region ; MODIFIER silent_mutation Average:56.433; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg1125037120 C -> DEL N N silent_mutation Average:56.433; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125037120 2.57E-22 1.49E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 3.40E-13 1.66E-08 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 4.13E-12 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 5.43E-08 NA mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 5.20E-18 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 1.37E-13 2.22E-08 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 3.87E-14 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 6.86E-08 NA mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 2.10E-17 2.49E-21 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 5.72E-12 1.29E-08 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 2.40E-08 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 6.76E-17 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 4.52E-12 3.11E-09 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 5.86E-16 4.71E-16 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 1.90E-13 1.56E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 9.88E-17 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 9.18E-09 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 6.24E-07 1.42E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 4.70E-06 4.70E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 3.00E-10 NA mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 1.01E-07 NA mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 1.54E-23 3.45E-29 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 4.97E-14 2.76E-09 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 3.70E-19 NA mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 7.16E-11 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 2.82E-25 3.83E-31 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 3.63E-10 3.63E-10 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 3.84E-13 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 1.28E-06 1.28E-06 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 1.97E-24 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 1.08E-15 2.73E-10 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 7.40E-22 1.69E-25 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 1.27E-14 3.74E-10 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 2.95E-20 4.61E-25 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 3.56E-09 3.56E-09 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 1.25E-12 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125037120 3.56E-09 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251