\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125032015:

Variant ID: vg1125032015 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25032015
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTCGCTATGGAAGAGTGTTTAAAGCTGATTTTGAAAATCCTGTTTCACCTGTGATAACATGTTTGGTTGCTAAGTTTGATAAGGATGTGATGTCTTGG[C/T]
ATCGTAGACTTGGACATGTTGGTTTTGATCATCTCACTAGGTTAAGTGGTTTGGATCTTGTTCGTGGTTTGACTAAACTTAAGAAAGATCTTGATTTGGT

Reverse complement sequence

ACCAAATCAAGATCTTTCTTAAGTTTAGTCAAACCACGAACAAGATCCAAACCACTTAACCTAGTGAGATGATCAAAACCAACATGTCCAAGTCTACGAT[G/A]
CCAAGACATCACATCCTTATCAAACTTAGCAACCAAACATGTTATCACAGGTGAAACAGGATTTTCAAAATCAGCTTTAAACACTCTTCCATAGCGAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 4.10% 1.93% 1.57% NA
All Indica  2759 97.00% 0.00% 1.88% 1.12% NA
All Japonica  1512 86.10% 12.70% 0.99% 0.20% NA
Aus  269 85.10% 0.00% 6.69% 8.18% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 91.60% 0.00% 5.59% 2.80% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 94.70% 0.00% 3.31% 2.04% NA
Temperate Japonica  767 77.30% 20.90% 1.56% 0.26% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 88.80% 9.50% 1.24% 0.41% NA
VI/Aromatic  96 79.20% 0.00% 4.17% 16.67% NA
Intermediate  90 94.40% 1.10% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125032015 C -> T LOC_Os11g41690.1 missense_variant ; p.His491Tyr; MODERATE nonsynonymous_codon ; H491Y Average:21.598; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 benign 0.746 DELETERIOUS 0.02
vg1125032015 C -> DEL LOC_Os11g41690.1 N frameshift_variant Average:21.598; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125032015 3.37E-11 1.17E-07 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 2.61E-07 NA mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 5.98E-12 3.43E-08 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 1.25E-06 NA mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 3.21E-11 1.54E-08 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 1.17E-09 1.34E-07 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 2.12E-13 5.24E-08 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 7.77E-08 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 8.16E-06 8.16E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 2.26E-07 NA mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 9.53E-14 1.27E-09 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 6.82E-08 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 4.05E-11 4.05E-11 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 7.94E-07 7.95E-07 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 1.75E-13 1.88E-09 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 8.59E-14 8.43E-10 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 1.78E-09 1.78E-09 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125032015 4.90E-08 NA mr1959_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251