\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125031400:

Variant ID: vg1125031400 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25031400
Reference Allele: CAlternative Allele: A,G,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCCCGCGGTCGGACCGGCGACCGGTCAGACTGGCTGAACAGCCTCGGTCAGACCGAGCACCGGTCAGACCGGCGGTACAGAGGCGGTCAGACCGGTCC[C/A,G,T]
CGGTCAGACCGGCCACTGTACCTCGGTCAGACCGGCCTCGGAGGAATTTTTCTGAAAATTCTAAAATTGATTTTGCATGTGGATTTATGCCTATTGGATC

Reverse complement sequence

GATCCAATAGGCATAAATCCACATGCAAAATCAATTTTAGAATTTTCAGAAAAATTCCTCCGAGGCCGGTCTGACCGAGGTACAGTGGCCGGTCTGACCG[G/T,C,A]
GGACCGGTCTGACCGCCTCTGTACCGCCGGTCTGACCGGTGCTCGGTCTGACCGAGGCTGTTCAGCCAGTCTGACCGGTCGCCGGTCCGACCGCGGGACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.80% 26.30% 0.89% 0.00% G: 0.02%; T: 0.02%
All Indica  2759 61.60% 37.80% 0.62% 0.00% NA
All Japonica  1512 95.20% 4.60% 0.13% 0.00% G: 0.07%
Aus  269 52.80% 42.40% 4.83% 0.00% NA
Indica I  595 60.70% 39.30% 0.00% 0.00% NA
Indica II  465 69.70% 29.00% 1.29% 0.00% NA
Indica III  913 50.80% 49.20% 0.00% 0.00% NA
Indica Intermediate  786 70.10% 28.50% 1.40% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 94.60% 5.00% 0.20% 0.00% G: 0.20%
Japonica Intermediate  241 91.30% 8.30% 0.41% 0.00% NA
VI/Aromatic  96 87.50% 3.10% 8.33% 0.00% T: 1.04%
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125031400 C -> T LOC_Os11g41700.1 downstream_gene_variant ; 4281.0bp to feature; MODIFIER silent_mutation Average:42.199; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1125031400 C -> T LOC_Os11g41690.1 intron_variant ; MODIFIER silent_mutation Average:42.199; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1125031400 C -> A LOC_Os11g41700.1 downstream_gene_variant ; 4281.0bp to feature; MODIFIER silent_mutation Average:42.199; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1125031400 C -> A LOC_Os11g41690.1 intron_variant ; MODIFIER silent_mutation Average:42.199; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1125031400 C -> G LOC_Os11g41700.1 downstream_gene_variant ; 4281.0bp to feature; MODIFIER silent_mutation Average:42.199; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1125031400 C -> G LOC_Os11g41690.1 intron_variant ; MODIFIER silent_mutation Average:42.199; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125031400 C A -0.02 -0.02 -0.02 -0.02 -0.02 -0.02
vg1125031400 C G -0.04 -0.03 -0.02 -0.03 -0.02 -0.03
vg1125031400 C T -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125031400 1.79E-06 5.31E-17 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 7.44E-06 5.60E-11 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 2.93E-06 NA mr1566 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 1.85E-07 8.01E-19 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 4.52E-07 2.30E-13 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 6.17E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 NA 6.45E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 1.56E-08 1.36E-27 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 5.90E-08 3.36E-19 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 NA 3.50E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 NA 2.50E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 1.41E-06 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 NA 6.50E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 1.67E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 NA 4.10E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 NA 2.30E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125031400 NA 1.01E-09 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251