\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125028775:

Variant ID: vg1125028775 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25028775
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCGAAATTTTTGTGAGGAGTGCTGTTGGTGCACTTTGTAAATACAGAGAGAATCAATAAAGTCGTCATCCACTTTAAGAGTTCTTCGATTTGTGTTTA[T/C]
CGGGTTTCGGCGGTCTAACCGGCGATCTACCGGTGGTCAGACTGGCAGCATAAGGGCGGTCAGACCGGCGGCAGCAGCAGGCACGGCAGGCGACTTCAGC

Reverse complement sequence

GCTGAAGTCGCCTGCCGTGCCTGCTGCTGCCGCCGGTCTGACCGCCCTTATGCTGCCAGTCTGACCACCGGTAGATCGCCGGTTAGACCGCCGAAACCCG[A/G]
TAAACACAAATCGAAGAACTCTTAAAGTGGATGACGACTTTATTGATTCTCTCTGTATTTACAAAGTGCACCAACAGCACTCCTCACAAAAATTTCGACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 6.40% 0.87% 1.97% NA
All Indica  2759 97.20% 0.30% 0.51% 2.07% NA
All Japonica  1512 81.40% 17.10% 1.39% 0.13% NA
Aus  269 79.90% 11.90% 1.86% 6.32% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 92.50% 0.00% 1.72% 5.81% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 94.90% 0.60% 0.64% 3.82% NA
Temperate Japonica  767 70.30% 28.30% 1.17% 0.26% NA
Tropical Japonica  504 96.40% 2.40% 1.19% 0.00% NA
Japonica Intermediate  241 85.50% 12.00% 2.49% 0.00% NA
VI/Aromatic  96 81.20% 3.10% 1.04% 14.58% NA
Intermediate  90 92.20% 4.40% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125028775 T -> DEL N N silent_mutation Average:43.742; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1125028775 T -> C LOC_Os11g41690.1 upstream_gene_variant ; 1075.0bp to feature; MODIFIER silent_mutation Average:43.742; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1125028775 T -> C LOC_Os11g41680-LOC_Os11g41690 intergenic_region ; MODIFIER silent_mutation Average:43.742; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125028775 3.07E-16 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 1.84E-09 3.34E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 5.22E-08 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 5.53E-06 NA mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 3.31E-12 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 5.98E-08 NA mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 1.03E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 1.74E-13 7.34E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 1.90E-09 6.08E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 2.15E-10 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 1.43E-08 1.12E-06 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 8.72E-12 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 3.67E-08 NA mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 8.95E-09 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 9.11E-06 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 6.12E-06 1.27E-09 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 NA 5.98E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 1.39E-09 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 3.04E-08 NA mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 7.19E-09 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 3.39E-07 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 3.46E-09 NA mr1484_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 9.22E-06 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 4.03E-12 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 4.57E-10 1.07E-06 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 1.40E-11 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 4.00E-10 8.15E-07 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 5.35E-08 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775 6.33E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251