Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125028775:

Variant ID: vg1125028775 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25028775
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTCGAAATTTTTGTGAGGAGTGCTGTTGGTGCACTTTGTAAATACAGAGAGAATCAATAAAGTCGTCATCCACTTTAAGAGTTCTTCGATTTGTGTTTA[T/C]
CGGGTTTCGGCGGTCTAACCGGCGATCTACCGGTGGTCAGACTGGCAGCATAAGGGCGGTCAGACCGGCGGCAGCAGCAGGCACGGCAGGCGACTTCAGC

Reverse complement sequence

GCTGAAGTCGCCTGCCGTGCCTGCTGCTGCCGCCGGTCTGACCGCCCTTATGCTGCCAGTCTGACCACCGGTAGATCGCCGGTTAGACCGCCGAAACCCG[A/G]
TAAACACAAATCGAAGAACTCTTAAAGTGGATGACGACTTTATTGATTCTCTCTGTATTTACAAAGTGCACCAACAGCACTCCTCACAAAAATTTCGACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.70%	6.40%	0.87%	1.97%	NA
All Indica	2759	97.20%	0.30%	0.51%	2.07%	NA
All Japonica	1512	81.40%	17.10%	1.39%	0.13%	NA
Aus	269	79.90%	11.90%	1.86%	6.32%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	92.50%	0.00%	1.72%	5.81%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	94.90%	0.60%	0.64%	3.82%	NA
Temperate Japonica	767	70.30%	28.30%	1.17%	0.26%	NA
Tropical Japonica	504	96.40%	2.40%	1.19%	0.00%	NA
Japonica Intermediate	241	85.50%	12.00%	2.49%	0.00%	NA
VI/Aromatic	96	81.20%	3.10%	1.04%	14.58%	NA
Intermediate	90	92.20%	4.40%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125028775	T -> DEL	N	N	silent_mutation	Average:43.742; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1125028775	T -> C	LOC_Os11g41690.1	upstream_gene_variant ; 1075.0bp to feature; MODIFIER	silent_mutation	Average:43.742; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1125028775	T -> C	LOC_Os11g41680-LOC_Os11g41690	intergenic_region ; MODIFIER	silent_mutation	Average:43.742; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125028775	3.07E-16	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	1.84E-09	3.34E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	5.22E-08	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	5.53E-06	NA	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	3.31E-12	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	5.98E-08	NA	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	1.03E-07	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	1.74E-13	7.34E-18	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	1.90E-09	6.08E-07	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	2.15E-10	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	1.43E-08	1.12E-06	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	8.72E-12	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	3.67E-08	NA	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	8.95E-09	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	9.11E-06	NA	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	6.12E-06	1.27E-09	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	NA	5.98E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	1.39E-09	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	3.04E-08	NA	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	7.19E-09	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	3.39E-07	NA	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	3.46E-09	NA	mr1484_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	9.22E-06	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	4.03E-12	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	4.57E-10	1.07E-06	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	1.40E-11	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	4.00E-10	8.15E-07	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	5.35E-08	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125028775	6.33E-06	NA	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251