\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125009665:

Variant ID: vg1125009665 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25009665
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.22, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAGGGCATGTTTTGATCCCTGATAAGTTTTTTTACCCTATCCCATCGAATGTTTGGACACATACATAAAGTATTAGATATAAAAAAAAAATAATTACA[C/T]
AGATTGCGTCTAAATTGCGAGATGAATCTTTTAAACCCAATTGCTCCAAGATTTGACAATGTGGTGCTATAGCAAACATTTGCTAATGACGGATTAATTA

Reverse complement sequence

TAATTAATCCGTCATTAGCAAATGTTTGCTATAGCACCACATTGTCAAATCTTGGAGCAATTGGGTTTAAAAGATTCATCTCGCAATTTAGACGCAATCT[G/A]
TGTAATTATTTTTTTTTTATATCTAATACTTTATGTATGTGTCCAAACATTCGATGGGATAGGGTAAAAAAACTTATCAGGGATCAAAACATGCCCTTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 34.60% 0.23% 3.41% NA
All Indica  2759 82.50% 14.00% 0.29% 3.26% NA
All Japonica  1512 25.40% 74.20% 0.20% 0.20% NA
Aus  269 68.80% 14.90% 0.00% 16.36% NA
Indica I  595 94.60% 4.40% 1.01% 0.00% NA
Indica II  465 68.60% 22.40% 0.22% 8.82% NA
Indica III  913 88.90% 10.80% 0.00% 0.22% NA
Indica Intermediate  786 73.90% 20.00% 0.13% 5.98% NA
Temperate Japonica  767 11.20% 88.10% 0.39% 0.26% NA
Tropical Japonica  504 39.90% 60.10% 0.00% 0.00% NA
Japonica Intermediate  241 40.20% 59.30% 0.00% 0.41% NA
VI/Aromatic  96 30.20% 50.00% 0.00% 19.79% NA
Intermediate  90 52.20% 42.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125009665 C -> T LOC_Os11g41670.1 upstream_gene_variant ; 329.0bp to feature; MODIFIER silent_mutation Average:42.076; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1125009665 C -> T LOC_Os11g41670-LOC_Os11g41680 intergenic_region ; MODIFIER silent_mutation Average:42.076; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1125009665 C -> DEL N N silent_mutation Average:42.076; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125009665 NA 4.80E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 3.80E-06 3.80E-06 mr1054 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 8.77E-06 mr1084 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 9.62E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 3.38E-07 mr1205 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 4.20E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 2.32E-06 mr1287 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 4.54E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 6.10E-06 6.10E-06 mr1372 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 7.35E-06 7.35E-06 mr1420 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 2.18E-06 2.18E-06 mr1573 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 1.54E-08 mr1596 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 1.86E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 8.41E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 4.09E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 4.26E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 1.66E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 1.06E-06 mr1906 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 7.78E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125009665 NA 5.32E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251