Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125004703:

Variant ID: vg1125004703 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25004703
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGTATGTTTTTTAGTTTTATTCCTTAGATCAACTCCCTCTATCAAAAAGACATCATTCCTAGCATCCCAAGGTAAAATTATAGTGAAGAGTAAAAAAT[A/G]
ACTAAAATGTCACTCGTTATTGAAAAAAGTAGTGATGGTAATAGACAGGTAAAGGGTATTTAAAAATAAAACTTGCCATTTTATCTGCTGAGGGTAGGAT

Reverse complement sequence

ATCCTACCCTCAGCAGATAAAATGGCAAGTTTTATTTTTAAATACCCTTTACCTGTCTATTACCATCACTACTTTTTTCAATAACGAGTGACATTTTAGT[T/C]
ATTTTTTACTCTTCACTATAATTTTACCTTGGGATGCTAGGAATGATGTCTTTTTGATAGAGGGAGTTGATCTAAGGAATAAAACTAAAAAACATACTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 39.00% 0.21% 3.24% NA
All Indica  2759 61.80% 34.80% 0.25% 3.15% NA
All Japonica  1512 50.60% 49.20% 0.00% 0.20% NA
Aus  269 62.50% 21.90% 1.12% 14.50% NA
Indica I  595 61.70% 38.00% 0.34% 0.00% NA
Indica II  465 45.80% 45.40% 0.00% 8.82% NA
Indica III  913 71.90% 27.80% 0.11% 0.22% NA
Indica Intermediate  786 59.80% 34.10% 0.51% 5.60% NA
Temperate Japonica  767 39.40% 60.40% 0.00% 0.26% NA
Tropical Japonica  504 63.10% 36.90% 0.00% 0.00% NA
Japonica Intermediate  241 60.20% 39.40% 0.00% 0.41% NA
VI/Aromatic  96 34.40% 45.80% 0.00% 19.79% NA
Intermediate  90 52.20% 42.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125004703 A -> DEL N N silent_mutation Average:63.681; most accessible tissue: Zhenshan97 root, score: 85.912 N N N N
vg1125004703 A -> G LOC_Os11g41670.1 downstream_gene_variant ; 164.0bp to feature; MODIFIER silent_mutation Average:63.681; most accessible tissue: Zhenshan97 root, score: 85.912 N N N N
vg1125004703 A -> G LOC_Os11g41650-LOC_Os11g41670 intergenic_region ; MODIFIER silent_mutation Average:63.681; most accessible tissue: Zhenshan97 root, score: 85.912 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125004703 A G -0.06 0.01 0.0 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125004703 1.32E-07 1.01E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 3.43E-08 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 1.47E-09 2.10E-10 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 5.78E-07 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 1.05E-09 4.94E-09 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 2.36E-07 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 1.29E-10 4.28E-11 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 8.53E-06 8.53E-06 mr1498 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 2.57E-06 2.57E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 9.09E-06 2.06E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 1.72E-06 4.12E-14 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 1.23E-07 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 2.60E-11 1.01E-11 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 8.41E-09 NA mr1900 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 1.60E-11 6.67E-13 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 3.01E-06 6.50E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 3.39E-07 5.91E-16 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 3.34E-08 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 1.78E-08 2.92E-08 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 3.19E-06 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 6.73E-07 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 2.27E-07 2.27E-07 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 2.74E-06 2.74E-06 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 1.49E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 5.10E-10 1.46E-09 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 9.43E-08 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 1.03E-08 4.94E-09 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 3.51E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125004703 8.38E-07 8.38E-07 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251