\
| Variant ID: vg1124998826 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24998826 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )
TTTCCTCGTCGGTGCCCAGTCATGGACCCCGGCCTTCATCAAACATGGATTTTATGGTTGCTTTTGCCTCGTTGGTGCCTAGCAACGGTGCATCCGGTTC[C/T]
CATCCATTTTAGACGTGTTAATAGTATAGTGACCTGGCCTTGTCGGCACTCGGCCATGGTTTCGTCTAGCCTCGTCGGTCATAGACAAATGAAATGAATG
CATTCATTTCATTTGTCTATGACCGACGAGGCTAGACGAAACCATGGCCGAGTGCCGACAAGGCCAGGTCACTATACTATTAACACGTCTAAAATGGATG[G/A]
GAACCGGATGCACCGTTGCTAGGCACCAACGAGGCAAAAGCAACCATAAAATCCATGTTTGATGAAGGCCGGGGTCCATGACTGGGCACCGACGAGGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.80% | 8.40% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.40% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 74.10% | 24.80% | 1.12% | 0.00% | NA |
| Aus | 269 | 98.10% | 0.40% | 1.49% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 67.40% | 31.70% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 80.40% | 18.10% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.20% | 17.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 2.10% | 8.33% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124998826 | C -> T | LOC_Os11g41650-LOC_Os11g41670 | intergenic_region ; MODIFIER | silent_mutation | Average:50.308; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124998826 | 8.34E-08 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 8.39E-07 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 9.36E-09 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 2.71E-07 | NA | mr1309 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 6.23E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 6.06E-06 | NA | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | NA | 1.03E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 3.52E-07 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 3.44E-06 | NA | mr1841 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 7.54E-10 | 6.72E-14 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 9.09E-08 | NA | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 2.56E-09 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 1.06E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 4.82E-10 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 4.87E-06 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 2.34E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 9.74E-09 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | NA | 4.85E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 3.01E-09 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 2.60E-07 | NA | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 1.23E-11 | 1.92E-19 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 5.46E-08 | NA | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 8.69E-08 | NA | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124998826 | 7.59E-06 | NA | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |