Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124998698:

Variant ID: vg1124998698 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24998698
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.23, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

TGAGGTTGGTGCAGATTTAACGGTGAATATAGTGAATGTGGAACGGGTTGCTTTGTTTCGCCAAAACCCGGTCACAGTACACTACCACCACGTCGGAGTG[T/C]
GGAGAGAATTTGGTGAAGCGGGTGACCTTTCCTCGTCGGTGCCCAGTCATGGACCCCGGCCTTCATCAAACATGGATTTTATGGTTGCTTTTGCCTCGTT

Reverse complement sequence

AACGAGGCAAAAGCAACCATAAAATCCATGTTTGATGAAGGCCGGGGTCCATGACTGGGCACCGACGAGGAAAGGTCACCCGCTTCACCAAATTCTCTCC[A/G]
CACTCCGACGTGGTGGTAGTGTACTGTGACCGGGTTTTGGCGAAACAAAGCAACCCGTTCCACATTCACTATATTCACCGTTAAATCTGCACCAACCTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	38.40%	1.14%	2.18%	NA
All Indica	2759	60.10%	36.70%	1.05%	2.14%	NA
All Japonica	1512	58.90%	40.80%	0.07%	0.20%	NA
Aus	269	28.30%	56.50%	7.81%	7.43%	NA
Indica I	595	64.90%	35.00%	0.17%	0.00%	NA
Indica II	465	62.80%	28.20%	2.58%	6.45%	NA
Indica III	913	51.80%	48.00%	0.11%	0.11%	NA
Indica Intermediate	786	64.60%	29.90%	1.91%	3.56%	NA
Temperate Japonica	767	58.40%	41.20%	0.13%	0.26%	NA
Tropical Japonica	504	65.50%	34.50%	0.00%	0.00%	NA
Japonica Intermediate	241	46.90%	52.70%	0.00%	0.41%	NA
VI/Aromatic	96	74.00%	6.20%	3.12%	16.67%	NA
Intermediate	90	65.60%	28.90%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124998698	T -> DEL	N	N	silent_mutation	Average:49.53; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1124998698	T -> C	LOC_Os11g41650-LOC_Os11g41670	intergenic_region ; MODIFIER	silent_mutation	Average:49.53; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124998698	1.66E-06	1.51E-09	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	3.17E-10	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	1.13E-17	2.07E-17	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	6.96E-06	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	6.46E-14	8.17E-13	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	2.20E-10	NA	mr1484	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	9.92E-17	5.00E-17	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	NA	1.98E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	7.93E-06	7.93E-06	mr1498	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	6.73E-10	6.73E-10	mr1609	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	4.01E-06	7.66E-09	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	3.68E-06	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	5.32E-17	7.42E-18	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	5.07E-16	2.64E-15	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	2.86E-07	2.86E-07	mr1945	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	1.70E-06	4.09E-06	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	8.49E-07	5.12E-14	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	7.40E-08	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	1.72E-15	3.55E-14	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	1.47E-07	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	6.63E-07	NA	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	3.41E-09	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	2.43E-12	2.43E-12	mr1484_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	8.69E-10	8.69E-10	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	NA	3.82E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	2.11E-09	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	8.84E-18	1.14E-16	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	5.57E-07	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	9.60E-17	5.94E-16	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	4.33E-06	4.33E-06	mr1925_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	5.15E-09	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124998698	3.09E-11	3.09E-11	mr1945_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251