Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124997485:

Variant ID: vg1124997485 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24997485
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

AATGGGCTTTTGTATTATGGGCCAAAACATCTAAAAAGTCTAGAATTAGTCATCTGTACAGTAAAGTCGGGTCACCGCGGGGGCGGGGACGCTCATCCCT[G/A,T]
ATGGTGAGAGGTTTGTAACCATTTTAGACTCCATGGTGAATACATATTAACCATCCCCGTCACCTAATAGGTGAATTCACCGCGGGGAAACGGTGAACAG

Reverse complement sequence

CTGTTCACCGTTTCCCCGCGGTGAATTCACCTATTAGGTGACGGGGATGGTTAATATGTATTCACCATGGAGTCTAAAATGGTTACAAACCTCTCACCAT[C/T,A]
AGGGATGAGCGTCCCCGCCCCCGCGGTGACCCGACTTTACTGTACAGATGACTAATTCTAGACTTTTTAGATGTTTTGGCCCATAATACAAAAGCCCATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.80%	24.80%	0.23%	3.11%	T: 0.04%
All Indica	2759	61.60%	35.20%	0.18%	3.01%	NA
All Japonica	1512	95.20%	4.60%	0.00%	0.20%	NA
Aus	269	43.50%	41.30%	0.74%	14.50%	NA
Indica I	595	65.40%	34.60%	0.00%	0.00%	NA
Indica II	465	63.20%	28.00%	0.22%	8.60%	NA
Indica III	913	53.20%	46.50%	0.11%	0.11%	NA
Indica Intermediate	786	67.40%	26.80%	0.38%	5.34%	NA
Temperate Japonica	767	96.60%	3.10%	0.00%	0.26%	NA
Tropical Japonica	504	94.80%	5.20%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	8.30%	0.00%	0.41%	NA
VI/Aromatic	96	77.10%	3.10%	2.08%	17.71%	NA
Intermediate	90	73.30%	16.70%	2.22%	5.56%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124997485	G -> T	LOC_Os11g41650.2	downstream_gene_variant ; 4020.0bp to feature; MODIFIER	silent_mutation	Average:69.59; most accessible tissue: Callus, score: 90.157	N	N	N	N
vg1124997485	G -> T	LOC_Os11g41650.1	downstream_gene_variant ; 4020.0bp to feature; MODIFIER	silent_mutation	Average:69.59; most accessible tissue: Callus, score: 90.157	N	N	N	N
vg1124997485	G -> T	LOC_Os11g41650-LOC_Os11g41670	intergenic_region ; MODIFIER	silent_mutation	Average:69.59; most accessible tissue: Callus, score: 90.157	N	N	N	N
vg1124997485	G -> A	LOC_Os11g41650.2	downstream_gene_variant ; 4020.0bp to feature; MODIFIER	silent_mutation	Average:69.59; most accessible tissue: Callus, score: 90.157	N	N	N	N
vg1124997485	G -> A	LOC_Os11g41650.1	downstream_gene_variant ; 4020.0bp to feature; MODIFIER	silent_mutation	Average:69.59; most accessible tissue: Callus, score: 90.157	N	N	N	N
vg1124997485	G -> A	LOC_Os11g41650-LOC_Os11g41670	intergenic_region ; MODIFIER	silent_mutation	Average:69.59; most accessible tissue: Callus, score: 90.157	N	N	N	N
vg1124997485	G -> DEL	N	N	silent_mutation	Average:69.59; most accessible tissue: Callus, score: 90.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124997485	4.25E-07	1.99E-16	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	9.02E-07	5.97E-11	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	1.58E-08	1.36E-18	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	2.01E-08	4.29E-13	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	NA	1.19E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	6.92E-06	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	6.91E-06	6.91E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	1.04E-09	1.79E-26	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	3.39E-09	4.61E-18	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	7.69E-06	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	NA	7.98E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	NA	3.94E-06	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	3.28E-08	NA	mr1609_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	6.73E-06	6.71E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	7.57E-07	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124997485	NA	8.27E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251