\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124991220:

Variant ID: vg1124991220 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24991220
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTTTCTCAAATAAAAATAATATAATCATTTGTAGTATTGATGTGTCTCATCACTTAACTCCCGTACAAAATTCTCTTATTTTTATTCCCAACTGTTAA[C/T]
GACCAAATTTGGTTTTTACATCAACACCAACCACCCCTCATTTAATAAGGGATGCTATAGTATTTTTTTTCTTAAACTGTAATCTCTCCTAGCCAATCTA

Reverse complement sequence

TAGATTGGCTAGGAGAGATTACAGTTTAAGAAAAAAAATACTATAGCATCCCTTATTAAATGAGGGGTGGTTGGTGTTGATGTAAAAACCAAATTTGGTC[G/A]
TTAACAGTTGGGAATAAAAATAAGAGAATTTTGTACGGGAGTTAAGTGATGAGACACATCAATACTACAAATGATTATATTATTTTTATTTGAGAAAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 6.30% 0.40% 2.48% NA
All Indica  2759 97.20% 0.10% 0.25% 2.46% NA
All Japonica  1512 80.70% 19.00% 0.26% 0.00% NA
Aus  269 86.60% 0.00% 2.97% 10.41% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 92.30% 0.00% 0.22% 7.53% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 94.90% 0.30% 0.76% 4.07% NA
Temperate Japonica  767 69.00% 30.50% 0.52% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 1.00% 0.00% 15.62% NA
Intermediate  90 88.90% 4.40% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124991220 C -> T LOC_Os11g41650.2 intron_variant ; MODIFIER silent_mutation Average:59.808; most accessible tissue: Callus, score: 83.452 N N N N
vg1124991220 C -> T LOC_Os11g41650.1 intron_variant ; MODIFIER silent_mutation Average:59.808; most accessible tissue: Callus, score: 83.452 N N N N
vg1124991220 C -> DEL N N silent_mutation Average:59.808; most accessible tissue: Callus, score: 83.452 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124991220 9.55E-20 1.22E-25 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 1.19E-11 5.84E-08 mr1238 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 5.71E-08 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 4.98E-18 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 3.53E-13 1.86E-08 mr1309 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 3.76E-08 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 2.36E-15 8.49E-20 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 1.81E-11 2.57E-08 mr1484 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 2.49E-06 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 2.59E-15 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 1.28E-11 2.12E-09 mr1841 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 8.10E-17 1.00E-17 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 3.01E-12 1.77E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 1.20E-10 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 6.93E-06 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 2.74E-06 3.76E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 4.84E-06 4.83E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 9.75E-07 NA mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 NA 7.99E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 6.78E-17 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 2.59E-11 3.73E-07 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 1.78E-11 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 4.07E-07 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 3.43E-17 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 1.05E-07 1.05E-07 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 9.39E-11 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 5.37E-20 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 4.22E-14 4.77E-09 mr1841_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 2.20E-19 4.59E-24 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 5.57E-13 6.27E-09 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 2.79E-12 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 2.92E-06 2.93E-06 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 2.39E-08 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124991220 3.88E-06 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251