Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124988847:

Variant ID: vg1124988847 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24988847
Reference Allele: C	Alternative Allele: T,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATAAATGATAAATGATAAAGTTACCTTTAATCACTGTATTACTTAAATTACTAATTTACACTTAATAACAAACAATACATATTATTTTTACTGGTAGTA[C/T,G]
GATACTATCAGTAGAGAGCACGAGTATCGTGCTTGGTGGATAATAATGGTGATGTGATTAACCTGTATTTATCGGCATCACCATCCTATAAATAGCTTTG

Reverse complement sequence

CAAAGCTATTTATAGGATGGTGATGCCGATAAATACAGGTTAATCACATCACCATTATTATCCACCAAGCACGATACTCGTGCTCTCTACTGATAGTATC[G/A,C]
TACTACCAGTAAAAATAATATGTATTGTTTGTTATTAAGTGTAAATTAGTAATTTAAGTAATACAGTGATTAAAGGTAACTTTATCATTTATCATTTATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.00%	6.60%	0.08%	3.32%	G: 0.02%
All Indica	2759	93.50%	3.30%	0.07%	3.12%	NA
All Japonica	1512	89.30%	10.40%	0.00%	0.20%	G: 0.07%
Aus	269	72.90%	10.40%	0.37%	16.36%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	90.30%	0.90%	0.00%	8.82%	NA
Indica III	913	93.10%	6.70%	0.00%	0.22%	NA
Indica Intermediate	786	91.50%	2.80%	0.25%	5.47%	NA
Temperate Japonica	767	95.20%	4.60%	0.00%	0.26%	NA
Tropical Japonica	504	80.20%	19.80%	0.00%	0.00%	NA
Japonica Intermediate	241	89.60%	9.50%	0.00%	0.41%	G: 0.41%
VI/Aromatic	96	55.20%	25.00%	0.00%	19.79%	NA
Intermediate	90	81.10%	12.20%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124988847	C -> T	LOC_Os11g41650.2	upstream_gene_variant ; 118.0bp to feature; MODIFIER	silent_mutation	Average:60.043; most accessible tissue: Minghui63 root, score: 89.304	N	N	N	N
vg1124988847	C -> T	LOC_Os11g41650.1	upstream_gene_variant ; 302.0bp to feature; MODIFIER	silent_mutation	Average:60.043; most accessible tissue: Minghui63 root, score: 89.304	N	N	N	N
vg1124988847	C -> T	LOC_Os11g41640.1	downstream_gene_variant ; 4598.0bp to feature; MODIFIER	silent_mutation	Average:60.043; most accessible tissue: Minghui63 root, score: 89.304	N	N	N	N
vg1124988847	C -> T	LOC_Os11g41640-LOC_Os11g41650	intergenic_region ; MODIFIER	silent_mutation	Average:60.043; most accessible tissue: Minghui63 root, score: 89.304	N	N	N	N
vg1124988847	C -> DEL	N	N	silent_mutation	Average:60.043; most accessible tissue: Minghui63 root, score: 89.304	N	N	N	N
vg1124988847	C -> G	LOC_Os11g41650.2	upstream_gene_variant ; 118.0bp to feature; MODIFIER	silent_mutation	Average:60.043; most accessible tissue: Minghui63 root, score: 89.304	N	N	N	N
vg1124988847	C -> G	LOC_Os11g41650.1	upstream_gene_variant ; 302.0bp to feature; MODIFIER	silent_mutation	Average:60.043; most accessible tissue: Minghui63 root, score: 89.304	N	N	N	N
vg1124988847	C -> G	LOC_Os11g41640.1	downstream_gene_variant ; 4598.0bp to feature; MODIFIER	silent_mutation	Average:60.043; most accessible tissue: Minghui63 root, score: 89.304	N	N	N	N
vg1124988847	C -> G	LOC_Os11g41640-LOC_Os11g41650	intergenic_region ; MODIFIER	silent_mutation	Average:60.043; most accessible tissue: Minghui63 root, score: 89.304	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124988847	1.39E-15	NA	mr1238	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	1.23E-09	6.19E-10	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	1.42E-11	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	NA	7.01E-07	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	1.76E-11	NA	mr1484	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	1.88E-09	1.55E-09	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	NA	4.32E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	NA	3.38E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	2.80E-12	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	9.79E-07	1.07E-06	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	5.73E-09	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	7.21E-06	1.19E-07	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	8.63E-16	NA	mr1238_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	5.25E-12	1.80E-12	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	5.53E-13	NA	mr1484_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	2.67E-10	2.67E-10	mr1484_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	3.97E-06	3.97E-06	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	2.20E-14	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	1.91E-09	6.90E-10	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	5.26E-11	NA	mr1900_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	3.00E-08	1.08E-08	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	1.33E-06	NA	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	1.12E-10	NA	mr1945_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988847	1.11E-10	1.11E-10	mr1945_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251