\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124988728:

Variant ID: vg1124988728 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24988728
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGATATAATTATTATTTAGCAGTAACTAAACTTTTTTTCTTTTGTTCTTTTTGGCAATTTTCGATCGGCGACGCTAGAGGAATGGATGACCACTAATC[A/G]
ATCTAGACATAAAAAAAACATAAATGATAAATGATAAAGTTACCTTTAATCACTGTATTACTTAAATTACTAATTTACACTTAATAACAAACAATACATA

Reverse complement sequence

TATGTATTGTTTGTTATTAAGTGTAAATTAGTAATTTAAGTAATACAGTGATTAAAGGTAACTTTATCATTTATCATTTATGTTTTTTTTATGTCTAGAT[T/C]
GATTAGTGGTCATCCATTCCTCTAGCGTCGCCGATCGAAAATTGCCAAAAAGAACAAAAGAAAAAAAGTTTAGTTACTGCTAAATAATAATTATATCTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 1.90% 0.51% 2.88% NA
All Indica  2759 95.70% 1.10% 0.43% 2.79% NA
All Japonica  1512 99.50% 0.20% 0.20% 0.07% NA
Aus  269 74.30% 10.00% 2.97% 12.64% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.80% 0.00% 0.86% 8.39% NA
Indica III  913 97.60% 2.20% 0.00% 0.22% NA
Indica Intermediate  786 93.10% 1.30% 1.02% 4.58% NA
Temperate Japonica  767 99.60% 0.00% 0.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 55.20% 24.00% 1.04% 19.79% NA
Intermediate  90 86.70% 7.80% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124988728 A -> DEL N N silent_mutation Average:46.728; most accessible tissue: Minghui63 root, score: 80.565 N N N N
vg1124988728 A -> G LOC_Os11g41650.2 upstream_gene_variant ; 237.0bp to feature; MODIFIER silent_mutation Average:46.728; most accessible tissue: Minghui63 root, score: 80.565 N N N N
vg1124988728 A -> G LOC_Os11g41650.1 upstream_gene_variant ; 421.0bp to feature; MODIFIER silent_mutation Average:46.728; most accessible tissue: Minghui63 root, score: 80.565 N N N N
vg1124988728 A -> G LOC_Os11g41640.1 downstream_gene_variant ; 4479.0bp to feature; MODIFIER silent_mutation Average:46.728; most accessible tissue: Minghui63 root, score: 80.565 N N N N
vg1124988728 A -> G LOC_Os11g41640-LOC_Os11g41650 intergenic_region ; MODIFIER silent_mutation Average:46.728; most accessible tissue: Minghui63 root, score: 80.565 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124988728 1.32E-08 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 7.63E-09 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 5.29E-06 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 4.57E-06 NA mr1566 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 3.38E-06 NA mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 4.27E-11 NA mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 3.72E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 1.68E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 1.62E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 2.77E-07 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 1.89E-11 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 2.15E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124988728 5.05E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251