\
| Variant ID: vg1124988728 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24988728 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGAGATATAATTATTATTTAGCAGTAACTAAACTTTTTTTCTTTTGTTCTTTTTGGCAATTTTCGATCGGCGACGCTAGAGGAATGGATGACCACTAATC[A/G]
ATCTAGACATAAAAAAAACATAAATGATAAATGATAAAGTTACCTTTAATCACTGTATTACTTAAATTACTAATTTACACTTAATAACAAACAATACATA
TATGTATTGTTTGTTATTAAGTGTAAATTAGTAATTTAAGTAATACAGTGATTAAAGGTAACTTTATCATTTATCATTTATGTTTTTTTTATGTCTAGAT[T/C]
GATTAGTGGTCATCCATTCCTCTAGCGTCGCCGATCGAAAATTGCCAAAAAGAACAAAAGAAAAAAAGTTTAGTTACTGCTAAATAATAATTATATCTCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 1.90% | 0.51% | 2.88% | NA |
| All Indica | 2759 | 95.70% | 1.10% | 0.43% | 2.79% | NA |
| All Japonica | 1512 | 99.50% | 0.20% | 0.20% | 0.07% | NA |
| Aus | 269 | 74.30% | 10.00% | 2.97% | 12.64% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.80% | 0.00% | 0.86% | 8.39% | NA |
| Indica III | 913 | 97.60% | 2.20% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 93.10% | 1.30% | 1.02% | 4.58% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 55.20% | 24.00% | 1.04% | 19.79% | NA |
| Intermediate | 90 | 86.70% | 7.80% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124988728 | A -> DEL | N | N | silent_mutation | Average:46.728; most accessible tissue: Minghui63 root, score: 80.565 | N | N | N | N |
| vg1124988728 | A -> G | LOC_Os11g41650.2 | upstream_gene_variant ; 237.0bp to feature; MODIFIER | silent_mutation | Average:46.728; most accessible tissue: Minghui63 root, score: 80.565 | N | N | N | N |
| vg1124988728 | A -> G | LOC_Os11g41650.1 | upstream_gene_variant ; 421.0bp to feature; MODIFIER | silent_mutation | Average:46.728; most accessible tissue: Minghui63 root, score: 80.565 | N | N | N | N |
| vg1124988728 | A -> G | LOC_Os11g41640.1 | downstream_gene_variant ; 4479.0bp to feature; MODIFIER | silent_mutation | Average:46.728; most accessible tissue: Minghui63 root, score: 80.565 | N | N | N | N |
| vg1124988728 | A -> G | LOC_Os11g41640-LOC_Os11g41650 | intergenic_region ; MODIFIER | silent_mutation | Average:46.728; most accessible tissue: Minghui63 root, score: 80.565 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124988728 | 1.32E-08 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 7.63E-09 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 5.29E-06 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 4.57E-06 | NA | mr1566 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 3.38E-06 | NA | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 4.27E-11 | NA | mr1841 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 3.72E-06 | NA | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 1.68E-07 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 1.62E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 2.77E-07 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 1.89E-11 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 2.15E-07 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124988728 | 5.05E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |