\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124985840:

Variant ID: vg1124985840 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24985840
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, T: 0.06, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


AATGGCTAACCTACACATGTTTCAGTTGGCTCTTGTGTGATGTGCTAGTGCTACATGTACTTATTATCATGTAAAAACTACTACAATTATTAAAATGACT[A/T]
TTTCCTTGTGGGCCAGAGGTAGTAGTATATATCATTTGTAACCTTGACCAATATAATAATTTTATATGTAAATAATTAGACTATGACAAAAGAAAGAAAG

Reverse complement sequence

CTTTCTTTCTTTTGTCATAGTCTAATTATTTACATATAAAATTATTATATTGGTCAAGGTTACAAATGATATATACTACTACCTCTGGCCCACAAGGAAA[T/A]
AGTCATTTTAATAATTGTAGTAGTTTTTACATGATAATAAGTACATGTAGCACTAGCACATCACACAAGAGCCAACTGAAACATGTGTAGGTTAGCCATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 35.80% 3.24% 0.30% NA
All Indica  2759 52.40% 44.00% 3.23% 0.29% NA
All Japonica  1512 80.00% 19.80% 0.20% 0.00% NA
Aus  269 28.30% 56.10% 14.50% 1.12% NA
Indica I  595 31.90% 67.60% 0.50% 0.00% NA
Indica II  465 61.30% 29.70% 8.60% 0.43% NA
Indica III  913 52.60% 46.70% 0.77% 0.00% NA
Indica Intermediate  786 62.60% 31.70% 4.96% 0.76% NA
Temperate Japonica  767 94.40% 5.30% 0.26% 0.00% NA
Tropical Japonica  504 66.10% 33.90% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.50% 0.41% 0.00% NA
VI/Aromatic  96 77.10% 3.10% 17.71% 2.08% NA
Intermediate  90 70.00% 23.30% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124985840 A -> T LOC_Os11g41650.2 upstream_gene_variant ; 3125.0bp to feature; MODIFIER silent_mutation Average:54.597; most accessible tissue: Minghui63 root, score: 88.175 N N N N
vg1124985840 A -> T LOC_Os11g41650.1 upstream_gene_variant ; 3309.0bp to feature; MODIFIER silent_mutation Average:54.597; most accessible tissue: Minghui63 root, score: 88.175 N N N N
vg1124985840 A -> T LOC_Os11g41640.1 downstream_gene_variant ; 1591.0bp to feature; MODIFIER silent_mutation Average:54.597; most accessible tissue: Minghui63 root, score: 88.175 N N N N
vg1124985840 A -> T LOC_Os11g41640-LOC_Os11g41650 intergenic_region ; MODIFIER silent_mutation Average:54.597; most accessible tissue: Minghui63 root, score: 88.175 N N N N
vg1124985840 A -> DEL N N silent_mutation Average:54.597; most accessible tissue: Minghui63 root, score: 88.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124985840 1.05E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 9.37E-07 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 NA 5.46E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 NA 1.82E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 2.39E-07 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 NA 8.64E-08 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 NA 1.26E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 1.54E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 8.68E-06 NA mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 NA 1.30E-06 mr1242_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 1.04E-06 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 NA 6.18E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 NA 2.71E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 NA 1.55E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 8.59E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 1.05E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 NA 2.60E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840 NA 6.30E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251