Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124985840:

Variant ID: vg1124985840 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24985840
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, T: 0.06, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:

AATGGCTAACCTACACATGTTTCAGTTGGCTCTTGTGTGATGTGCTAGTGCTACATGTACTTATTATCATGTAAAAACTACTACAATTATTAAAATGACT[A/T]
TTTCCTTGTGGGCCAGAGGTAGTAGTATATATCATTTGTAACCTTGACCAATATAATAATTTTATATGTAAATAATTAGACTATGACAAAAGAAAGAAAG

Reverse complement sequence

CTTTCTTTCTTTTGTCATAGTCTAATTATTTACATATAAAATTATTATATTGGTCAAGGTTACAAATGATATATACTACTACCTCTGGCCCACAAGGAAA[T/A]
AGTCATTTTAATAATTGTAGTAGTTTTTACATGATAATAAGTACATGTAGCACTAGCACATCACACAAGAGCCAACTGAAACATGTGTAGGTTAGCCATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	35.80%	3.24%	0.30%	NA
All Indica	2759	52.40%	44.00%	3.23%	0.29%	NA
All Japonica	1512	80.00%	19.80%	0.20%	0.00%	NA
Aus	269	28.30%	56.10%	14.50%	1.12%	NA
Indica I	595	31.90%	67.60%	0.50%	0.00%	NA
Indica II	465	61.30%	29.70%	8.60%	0.43%	NA
Indica III	913	52.60%	46.70%	0.77%	0.00%	NA
Indica Intermediate	786	62.60%	31.70%	4.96%	0.76%	NA
Temperate Japonica	767	94.40%	5.30%	0.26%	0.00%	NA
Tropical Japonica	504	66.10%	33.90%	0.00%	0.00%	NA
Japonica Intermediate	241	63.10%	36.50%	0.41%	0.00%	NA
VI/Aromatic	96	77.10%	3.10%	17.71%	2.08%	NA
Intermediate	90	70.00%	23.30%	5.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124985840	A -> T	LOC_Os11g41650.2	upstream_gene_variant ; 3125.0bp to feature; MODIFIER	silent_mutation	Average:54.597; most accessible tissue: Minghui63 root, score: 88.175	N	N	N	N
vg1124985840	A -> T	LOC_Os11g41650.1	upstream_gene_variant ; 3309.0bp to feature; MODIFIER	silent_mutation	Average:54.597; most accessible tissue: Minghui63 root, score: 88.175	N	N	N	N
vg1124985840	A -> T	LOC_Os11g41640.1	downstream_gene_variant ; 1591.0bp to feature; MODIFIER	silent_mutation	Average:54.597; most accessible tissue: Minghui63 root, score: 88.175	N	N	N	N
vg1124985840	A -> T	LOC_Os11g41640-LOC_Os11g41650	intergenic_region ; MODIFIER	silent_mutation	Average:54.597; most accessible tissue: Minghui63 root, score: 88.175	N	N	N	N
vg1124985840	A -> DEL	N	N	silent_mutation	Average:54.597; most accessible tissue: Minghui63 root, score: 88.175	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124985840	1.05E-06	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	9.37E-07	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	NA	5.46E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	NA	1.82E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	2.39E-07	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	NA	8.64E-08	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	NA	1.26E-07	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	1.54E-06	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	8.68E-06	NA	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	NA	1.30E-06	mr1242_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	1.04E-06	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	NA	6.18E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	NA	2.71E-07	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	NA	1.55E-06	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	8.59E-08	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	1.05E-07	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	NA	2.60E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124985840	NA	6.30E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251