\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124975731:

Variant ID: vg1124975731 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24975731
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CATTTTTGCTATATTTTTTAGAGGATGATGGATCAACTGTGCCGTCCAGTGTATATTTTTAGTTTGAGTAAAATACATGGCCGGTCCTTAAACTTGAGCG[C/T]
GGGTGTTACTTAGGTCCACAATCTTGTAAATTGCAGAGTCAAATCCACCATCTTAGTTTAATGATACATGGCAGGTTCAAACCCCACTTCTGGCTCAGAC

Reverse complement sequence

GTCTGAGCCAGAAGTGGGGTTTGAACCTGCCATGTATCATTAAACTAAGATGGTGGATTTGACTCTGCAATTTACAAGATTGTGGACCTAAGTAACACCC[G/A]
CGCTCAAGTTTAAGGACCGGCCATGTATTTTACTCAAACTAAAAATATACACTGGACGGCACAGTTGATCCATCATCCTCTAAAAAATATAGCAAAAATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 35.80% 0.23% 3.47% NA
All Indica  2759 52.40% 44.00% 0.36% 3.26% NA
All Japonica  1512 80.00% 19.80% 0.00% 0.20% NA
Aus  269 27.10% 55.80% 0.00% 17.10% NA
Indica I  595 32.10% 67.70% 0.17% 0.00% NA
Indica II  465 60.40% 29.20% 1.29% 9.03% NA
Indica III  913 53.20% 46.50% 0.00% 0.22% NA
Indica Intermediate  786 62.00% 31.80% 0.38% 5.85% NA
Temperate Japonica  767 94.40% 5.30% 0.00% 0.26% NA
Tropical Japonica  504 66.10% 33.90% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.50% 0.00% 0.41% NA
VI/Aromatic  96 76.00% 3.10% 1.04% 19.79% NA
Intermediate  90 66.70% 26.70% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124975731 C -> T LOC_Os11g41620.1 upstream_gene_variant ; 417.0bp to feature; MODIFIER silent_mutation Average:63.655; most accessible tissue: Callus, score: 90.535 N N N N
vg1124975731 C -> T LOC_Os11g41610.1 downstream_gene_variant ; 681.0bp to feature; MODIFIER silent_mutation Average:63.655; most accessible tissue: Callus, score: 90.535 N N N N
vg1124975731 C -> T LOC_Os11g41630.1 downstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:63.655; most accessible tissue: Callus, score: 90.535 N N N N
vg1124975731 C -> T LOC_Os11g41610-LOC_Os11g41620 intergenic_region ; MODIFIER silent_mutation Average:63.655; most accessible tissue: Callus, score: 90.535 N N N N
vg1124975731 C -> DEL N N silent_mutation Average:63.655; most accessible tissue: Callus, score: 90.535 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124975731 4.06E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 3.64E-07 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 NA 2.75E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 8.33E-06 NA mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 1.70E-07 NA mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 8.36E-06 3.98E-08 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 NA 7.99E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 NA 4.20E-08 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 9.19E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 9.25E-06 NA mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 NA 1.59E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 3.80E-06 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 NA 2.52E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 NA 1.89E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 NA 1.26E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 5.37E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 1.38E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 NA 3.30E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124975731 NA 8.33E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251