\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124965681:

Variant ID: vg1124965681 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24965681
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTTCTATTTTTCTTAAAGTATCTTAAAAAAAACCATTCACAAACTTTTGAGTAGGAGATGGATTAAGTACTTATGACTTGAATCTTGTTTTTTTTCTC[G/A]
AGTAAATAAGAAACTATTGGAAGTTAATTATTATACAATCCATTTATAGAGCAAGATACTTAAAATTCTTATGATTAAATCATCTCATGAAGACGCATGA

Reverse complement sequence

TCATGCGTCTTCATGAGATGATTTAATCATAAGAATTTTAAGTATCTTGCTCTATAAATGGATTGTATAATAATTAACTTCCAATAGTTTCTTATTTACT[C/T]
GAGAAAAAAAACAAGATTCAAGTCATAAGTACTTAATCCATCTCCTACTCAAAAGTTTGTGAATGGTTTTTTTTAAGATACTTTAAGAAAAATAGAACCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 8.60% 0.53% 0.00% NA
All Indica  2759 87.40% 12.20% 0.43% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.13% 0.00% NA
Aus  269 82.50% 14.10% 3.35% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 72.50% 26.20% 1.29% 0.00% NA
Indica III  913 91.70% 8.10% 0.22% 0.00% NA
Indica Intermediate  786 82.20% 17.30% 0.51% 0.00% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124965681 G -> A LOC_Os11g41600-LOC_Os11g41610 intergenic_region ; MODIFIER silent_mutation Average:20.257; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124965681 5.81E-16 1.20E-14 mr1238 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 1.04E-12 2.26E-13 mr1309 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 9.81E-09 NA mr1609 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 3.22E-10 1.83E-13 mr1609 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 2.12E-12 1.74E-12 mr1841 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 9.57E-08 9.57E-08 mr1900 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 1.39E-10 1.91E-12 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 3.64E-08 2.60E-09 mr1484_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 1.09E-08 NA mr1609_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 2.73E-11 3.74E-16 mr1609_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 NA 3.23E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 9.13E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 2.20E-13 4.10E-13 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 5.79E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 1.49E-12 2.90E-13 mr1900_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 NA 5.38E-07 mr1944_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965681 6.15E-06 6.15E-06 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251