\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124965463:

Variant ID: vg1124965463 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24965463
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTTAAAATGTAAAAATTATATGAATAGATTTGTCTTGAAAAATGCTTTCATAAAAGTATACATATATCACTTTTCAATAAATAACTAGAAGGTGGCC[C/T,A]
GCGCGAATGCGCGGGCATTATATTATTGAAAGATAAGATTATTGTTTGTTCGAAAATTTTGTCTCATAAATTAAGGGCAAACTAATGTTTGGATAATGTT

Reverse complement sequence

AACATTATCCAAACATTAGTTTGCCCTTAATTTATGAGACAAAATTTTCGAACAAACAATAATCTTATCTTTCAATAATATAATGCCCGCGCATTCGCGC[G/A,T]
GGCCACCTTCTAGTTATTTATTGAAAAGTGATATATGTATACTTTTATGAAAGCATTTTTCAAGACAAATCTATTCATATAATTTTTACATTTTAAAACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 42.60% 0.08% 0.00% A: 0.11%
All Indica  2759 82.70% 17.00% 0.11% 0.00% A: 0.18%
All Japonica  1512 16.10% 83.80% 0.07% 0.00% NA
Aus  269 46.10% 53.90% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 68.20% 31.80% 0.00% 0.00% NA
Indica III  913 87.40% 12.20% 0.22% 0.00% A: 0.22%
Indica Intermediate  786 74.00% 25.60% 0.00% 0.00% A: 0.38%
Temperate Japonica  767 4.20% 95.70% 0.13% 0.00% NA
Tropical Japonica  504 33.10% 66.90% 0.00% 0.00% NA
Japonica Intermediate  241 18.70% 81.30% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124965463 C -> T LOC_Os11g41600-LOC_Os11g41610 intergenic_region ; MODIFIER silent_mutation Average:24.357; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1124965463 C -> A LOC_Os11g41600-LOC_Os11g41610 intergenic_region ; MODIFIER silent_mutation Average:24.357; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124965463 1.84E-10 2.64E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 7.36E-10 1.24E-09 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 2.08E-09 1.34E-28 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 4.89E-09 3.96E-10 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 6.21E-06 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 NA 5.48E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 3.91E-10 3.16E-20 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 2.04E-06 2.80E-09 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 6.02E-10 7.83E-29 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 3.41E-08 1.37E-08 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 1.06E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 NA 2.83E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 3.63E-10 4.01E-29 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 2.03E-06 7.73E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 2.03E-08 6.23E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 8.98E-06 8.53E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 4.46E-12 8.64E-34 mr1609_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 7.44E-07 7.15E-10 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 7.25E-11 4.71E-34 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 9.37E-08 2.85E-07 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 4.15E-13 7.33E-25 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 3.02E-08 1.37E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 NA 8.60E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124965463 5.71E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251