\
| Variant ID: vg1124963993 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24963993 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 112. )
TGCTTTATTTGTTTTTCCAATACTTATCAGACATAAAACAAATGATGAGATTCATTTTTTAGTAAATTACACTTTGGTCCAGCTTTTATTACCCAAGTTT[T/C]
ACTCTGGACCCCCCCCTAAATCTATCTTTTCAATTTGGACCGGATAAATTTACCATTGTTGCGGTTTGGACTACCATGAACAACTTTTCTCATCATGTCT
AGACATGATGAGAAAAGTTGTTCATGGTAGTCCAAACCGCAACAATGGTAAATTTATCCGGTCCAAATTGAAAAGATAGATTTAGGGGGGGGTCCAGAGT[A/G]
AAACTTGGGTAATAAAAGCTGGACCAAAGTGTAATTTACTAAAAAATGAATCTCATCATTTGTTTTATGTCTGATAAGTATTGGAAAAACAAATAAAGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.80% | 14.00% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 94.10% | 5.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 79.80% | 19.40% | 0.79% | 0.00% | NA |
| Aus | 269 | 47.60% | 52.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.60% | 3.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.20% | 9.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 89.20% | 9.50% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.00% | 33.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124963993 | T -> C | LOC_Os11g41600-LOC_Os11g41610 | intergenic_region ; MODIFIER | silent_mutation | Average:48.106; most accessible tissue: Callus, score: 77.215 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124963993 | 2.56E-13 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 1.08E-08 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 5.89E-10 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 3.41E-06 | NA | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | NA | 1.77E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | NA | 2.72E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 3.10E-10 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 1.96E-07 | NA | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | NA | 8.75E-06 | mr1906 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 1.83E-06 | 5.64E-07 | mr1925 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 1.76E-06 | NA | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | NA | 7.75E-06 | mr1170_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 9.36E-10 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 6.68E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 5.85E-06 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 3.47E-11 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 1.43E-09 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 8.45E-06 | 2.09E-07 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124963993 | 8.70E-07 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |