Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1124958705:

Variant ID: vg1124958705 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24958705
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.08, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGCCCCTGTTTGTTGATATTTTTCTTTAACTTATAGTGTTATCTAACAACTCAACTAATATAGAGCATATATTGGCCAGTATTTGAAATTAAAGTTAA[C/A]
TTGACATCAAAAACTAATTTCTTAGTTCCTAAACTAACCATATGATGATTAATTTTGTTTCATACCTCTCCGATTTTTAATGTATAACACTATTTACTTT

Reverse complement sequence

AAAGTAAATAGTGTTATACATTAAAAATCGGAGAGGTATGAAACAAAATTAATCATCATATGGTTAGTTTAGGAACTAAGAAATTAGTTTTTGATGTCAA[G/T]
TTAACTTTAATTTCAAATACTGGCCAATATATGCTCTATATTAGTTGAGTTGTTAGATAACACTATAAGTTAAAGAAAAATATCAACAAACAGGGGCCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 37.00% 0.04% 0.00% NA
All Indica  2759 92.10% 7.90% 0.04% 0.00% NA
All Japonica  1512 16.40% 83.50% 0.07% 0.00% NA
Aus  269 46.80% 53.20% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 85.60% 14.20% 0.22% 0.00% NA
Indica III  913 95.30% 4.70% 0.00% 0.00% NA
Indica Intermediate  786 86.50% 13.50% 0.00% 0.00% NA
Temperate Japonica  767 4.40% 95.60% 0.00% 0.00% NA
Tropical Japonica  504 33.50% 66.50% 0.00% 0.00% NA
Japonica Intermediate  241 18.70% 80.90% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124958705 C -> A LOC_Os11g41600-LOC_Os11g41610 intergenic_region ; MODIFIER silent_mutation Average:40.763; most accessible tissue: Minghui63 root, score: 69.344 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124958705 6.93E-11 2.01E-29 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 1.53E-09 5.10E-11 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 1.66E-09 1.64E-31 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 6.91E-09 2.12E-10 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 5.60E-07 2.96E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 1.70E-06 1.52E-06 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 NA 1.10E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 NA 2.24E-13 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 5.80E-09 4.88E-31 mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 3.45E-06 2.68E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 7.65E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 1.46E-06 1.95E-13 mr1945 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 1.72E-10 4.28E-31 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 2.92E-07 1.80E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 6.42E-10 1.40E-28 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 5.55E-09 3.57E-08 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 7.55E-08 7.95E-27 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 NA 5.91E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 1.07E-11 6.41E-39 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 3.89E-08 9.46E-08 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 1.73E-11 8.91E-23 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 4.32E-06 NA mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 NA 4.11E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124958705 2.05E-07 7.17E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251