\
| Variant ID: vg1124929928 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24929928 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAGTGTGTTATGGCAGGGAGCACTGTATGTGCATTCTGGAGGGGCTTGTGTTACAAGGTAAAAAAAAAAAAACATCACCACTCTATATATGTTTTGCCAT[G/C]
AATTTTATCGATTCATTGCAATTTTGATTGATAGATATATCTTTTGCTTAAATTGTCAACAAATAGTTAATAAAAAGGGTTTTTTGTCTTTATAGCTGAT
ATCAGCTATAAAGACAAAAAACCCTTTTTATTAACTATTTGTTGACAATTTAAGCAAAAGATATATCTATCAATCAAAATTGCAATGAATCGATAAAATT[C/G]
ATGGCAAAACATATATAGAGTGGTGATGTTTTTTTTTTTTTACCTTGTAACACAAGCCCCTCCAGAATGCACATACAGTGCTCCCTGCCATAACACACTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 6.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 83.30% | 16.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 76.40% | 23.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.50% | 29.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124929928 | G -> C | LOC_Os11g41560.1 | upstream_gene_variant ; 2613.0bp to feature; MODIFIER | silent_mutation | Average:70.975; most accessible tissue: Minghui63 flag leaf, score: 85.327 | N | N | N | N |
| vg1124929928 | G -> C | LOC_Os11g41550.1 | intron_variant ; MODIFIER | silent_mutation | Average:70.975; most accessible tissue: Minghui63 flag leaf, score: 85.327 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124929928 | 1.21E-08 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | NA | 2.72E-07 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | 2.73E-10 | NA | mr1238_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | 5.22E-07 | 2.55E-08 | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | NA | 5.74E-06 | mr1388_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | 1.81E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | 1.52E-06 | 1.52E-06 | mr1484_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | 3.28E-09 | NA | mr1841_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | 3.37E-06 | 4.61E-08 | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | 2.80E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | NA | 2.41E-06 | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | 3.44E-09 | NA | mr1945_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124929928 | 9.47E-08 | 9.47E-08 | mr1945_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |