RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1124928261:

Variant ID: vg1124928261 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24928261
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, A: 0.33, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTAGGTAAGTTTGGCGTGTTATCATCTTTTGTGTACACTCCCTGCATGATCGTAGAACTTCATGGATACTAACTAGCTCATCTTGAAGAATAGGAAAC[A/T]
GATAAAATGCTCTCTGCATCCTTTCTTTTGGAATCCACCATCATAGACGTTGGTTTCGACCTGTGGATCTGCACTCATCGACAGGCCTATGTGATCGCGT

Reverse complement sequence

ACGCGATCACATAGGCCTGTCGATGAGTGCAGATCCACAGGTCGAAACCAACGTCTATGATGGTGGATTCCAAAAGAAAGGATGCAGAGAGCATTTTATC[T/A]
GTTTCCTATTCTTCAAGATGAGCTAGTTAGTATCCATGAAGTTCTACGATCATGCAGGGAGTGTACACAAAAGATGATAACACGCCAAACTTACCTACAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.50%	17.90%	0.23%	61.36%	NA
All Indica	2759	15.40%	1.80%	0.25%	82.49%	NA
All Japonica	1512	27.40%	49.00%	0.07%	23.48%	NA
Aus	269	18.60%	12.60%	0.00%	68.77%	NA
Indica I	595	21.00%	0.70%	0.17%	78.15%	NA
Indica II	465	13.30%	1.90%	0.65%	84.09%	NA
Indica III	913	14.90%	0.40%	0.11%	84.56%	NA
Indica Intermediate	786	13.10%	4.20%	0.25%	82.44%	NA
Temperate Japonica	767	8.60%	81.50%	0.00%	9.91%	NA
Tropical Japonica	504	60.50%	6.00%	0.00%	33.53%	NA
Japonica Intermediate	241	18.30%	35.70%	0.41%	45.64%	NA
VI/Aromatic	96	58.30%	2.10%	1.04%	38.54%	NA
Intermediate	90	26.70%	18.90%	2.22%	52.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124928261	A -> T	LOC_Os11g41550.1	upstream_gene_variant ; 746.0bp to feature; MODIFIER	silent_mutation	Average:12.7; most accessible tissue: Callus, score: 85.806	N	N	N	N
vg1124928261	A -> T	LOC_Os11g41560.1	upstream_gene_variant ; 4280.0bp to feature; MODIFIER	silent_mutation	Average:12.7; most accessible tissue: Callus, score: 85.806	N	N	N	N
vg1124928261	A -> T	LOC_Os11g41540-LOC_Os11g41550	intergenic_region ; MODIFIER	silent_mutation	Average:12.7; most accessible tissue: Callus, score: 85.806	N	N	N	N
vg1124928261	A -> DEL	N	N	silent_mutation	Average:12.7; most accessible tissue: Callus, score: 85.806	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124928261	2.09E-06	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261	3.20E-06	NA	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261	1.58E-06	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261	NA	2.07E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261	3.69E-07	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261	2.91E-06	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261	NA	6.10E-08	mr1195_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261	5.87E-09	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261	9.56E-07	5.94E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261	1.88E-08	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 18 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1124928261:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact