\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124928261:

Variant ID: vg1124928261 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24928261
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, A: 0.33, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTAGGTAAGTTTGGCGTGTTATCATCTTTTGTGTACACTCCCTGCATGATCGTAGAACTTCATGGATACTAACTAGCTCATCTTGAAGAATAGGAAAC[A/T]
GATAAAATGCTCTCTGCATCCTTTCTTTTGGAATCCACCATCATAGACGTTGGTTTCGACCTGTGGATCTGCACTCATCGACAGGCCTATGTGATCGCGT

Reverse complement sequence

ACGCGATCACATAGGCCTGTCGATGAGTGCAGATCCACAGGTCGAAACCAACGTCTATGATGGTGGATTCCAAAAGAAAGGATGCAGAGAGCATTTTATC[T/A]
GTTTCCTATTCTTCAAGATGAGCTAGTTAGTATCCATGAAGTTCTACGATCATGCAGGGAGTGTACACAAAAGATGATAACACGCCAAACTTACCTACAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.50% 17.90% 0.23% 61.36% NA
All Indica  2759 15.40% 1.80% 0.25% 82.49% NA
All Japonica  1512 27.40% 49.00% 0.07% 23.48% NA
Aus  269 18.60% 12.60% 0.00% 68.77% NA
Indica I  595 21.00% 0.70% 0.17% 78.15% NA
Indica II  465 13.30% 1.90% 0.65% 84.09% NA
Indica III  913 14.90% 0.40% 0.11% 84.56% NA
Indica Intermediate  786 13.10% 4.20% 0.25% 82.44% NA
Temperate Japonica  767 8.60% 81.50% 0.00% 9.91% NA
Tropical Japonica  504 60.50% 6.00% 0.00% 33.53% NA
Japonica Intermediate  241 18.30% 35.70% 0.41% 45.64% NA
VI/Aromatic  96 58.30% 2.10% 1.04% 38.54% NA
Intermediate  90 26.70% 18.90% 2.22% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124928261 A -> T LOC_Os11g41550.1 upstream_gene_variant ; 746.0bp to feature; MODIFIER silent_mutation Average:12.7; most accessible tissue: Callus, score: 85.806 N N N N
vg1124928261 A -> T LOC_Os11g41560.1 upstream_gene_variant ; 4280.0bp to feature; MODIFIER silent_mutation Average:12.7; most accessible tissue: Callus, score: 85.806 N N N N
vg1124928261 A -> T LOC_Os11g41540-LOC_Os11g41550 intergenic_region ; MODIFIER silent_mutation Average:12.7; most accessible tissue: Callus, score: 85.806 N N N N
vg1124928261 A -> DEL N N silent_mutation Average:12.7; most accessible tissue: Callus, score: 85.806 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124928261 2.09E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 3.20E-06 NA mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 1.58E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 NA 2.07E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 3.69E-07 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 2.91E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 NA 6.10E-08 mr1195_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 5.87E-09 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 9.56E-07 5.94E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 1.88E-08 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 4.20E-07 1.87E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 NA 6.08E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 1.39E-07 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 6.83E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 2.33E-06 NA mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 2.42E-09 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 1.09E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124928261 NA 4.64E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251