\
| Variant ID: vg1124928261 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24928261 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, A: 0.33, others allele: 0.00, population size: 89. )
CTGTAGGTAAGTTTGGCGTGTTATCATCTTTTGTGTACACTCCCTGCATGATCGTAGAACTTCATGGATACTAACTAGCTCATCTTGAAGAATAGGAAAC[A/T]
GATAAAATGCTCTCTGCATCCTTTCTTTTGGAATCCACCATCATAGACGTTGGTTTCGACCTGTGGATCTGCACTCATCGACAGGCCTATGTGATCGCGT
ACGCGATCACATAGGCCTGTCGATGAGTGCAGATCCACAGGTCGAAACCAACGTCTATGATGGTGGATTCCAAAAGAAAGGATGCAGAGAGCATTTTATC[T/A]
GTTTCCTATTCTTCAAGATGAGCTAGTTAGTATCCATGAAGTTCTACGATCATGCAGGGAGTGTACACAAAAGATGATAACACGCCAAACTTACCTACAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.50% | 17.90% | 0.23% | 61.36% | NA |
| All Indica | 2759 | 15.40% | 1.80% | 0.25% | 82.49% | NA |
| All Japonica | 1512 | 27.40% | 49.00% | 0.07% | 23.48% | NA |
| Aus | 269 | 18.60% | 12.60% | 0.00% | 68.77% | NA |
| Indica I | 595 | 21.00% | 0.70% | 0.17% | 78.15% | NA |
| Indica II | 465 | 13.30% | 1.90% | 0.65% | 84.09% | NA |
| Indica III | 913 | 14.90% | 0.40% | 0.11% | 84.56% | NA |
| Indica Intermediate | 786 | 13.10% | 4.20% | 0.25% | 82.44% | NA |
| Temperate Japonica | 767 | 8.60% | 81.50% | 0.00% | 9.91% | NA |
| Tropical Japonica | 504 | 60.50% | 6.00% | 0.00% | 33.53% | NA |
| Japonica Intermediate | 241 | 18.30% | 35.70% | 0.41% | 45.64% | NA |
| VI/Aromatic | 96 | 58.30% | 2.10% | 1.04% | 38.54% | NA |
| Intermediate | 90 | 26.70% | 18.90% | 2.22% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124928261 | A -> T | LOC_Os11g41550.1 | upstream_gene_variant ; 746.0bp to feature; MODIFIER | silent_mutation | Average:12.7; most accessible tissue: Callus, score: 85.806 | N | N | N | N |
| vg1124928261 | A -> T | LOC_Os11g41560.1 | upstream_gene_variant ; 4280.0bp to feature; MODIFIER | silent_mutation | Average:12.7; most accessible tissue: Callus, score: 85.806 | N | N | N | N |
| vg1124928261 | A -> T | LOC_Os11g41540-LOC_Os11g41550 | intergenic_region ; MODIFIER | silent_mutation | Average:12.7; most accessible tissue: Callus, score: 85.806 | N | N | N | N |
| vg1124928261 | A -> DEL | N | N | silent_mutation | Average:12.7; most accessible tissue: Callus, score: 85.806 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124928261 | 2.09E-06 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 3.20E-06 | NA | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 1.58E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | NA | 2.07E-08 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 3.69E-07 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 2.91E-06 | NA | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | NA | 6.10E-08 | mr1195_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 5.87E-09 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 9.56E-07 | 5.94E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 1.88E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 4.20E-07 | 1.87E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | NA | 6.08E-07 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 1.39E-07 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 6.83E-08 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 2.33E-06 | NA | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 2.42E-09 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | 1.09E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124928261 | NA | 4.64E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |