Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124908110:

Variant ID: vg1124908110 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24908110
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGTGGAGTTCATCTTGATACCAGGACGAGGAAGGCTAGCGCTGAAGGCCATCTCACAAACCCAAAGAACGAACTACACAACGGGAGGACCCCAACCAAC[C/T]
AAGAAACCCCGACTAAACTATACCTATAGTACTAGGGAGGAAGGACCGGACCCCTCTCCCTCCCTCTGTCGACGACGAATCGTCGGAGCAGGGGCCGAAC

Reverse complement sequence

GTTCGGCCCCTGCTCCGACGATTCGTCGTCGACAGAGGGAGGGAGAGGGGTCCGGTCCTTCCTCCCTAGTACTATAGGTATAGTTTAGTCGGGGTTTCTT[G/A]
GTTGGTTGGGGTCCTCCCGTTGTGTAGTTCGTTCTTTGGGTTTGTGAGATGGCCTTCAGCGCTAGCCTTCCTCGTCCTGGTATCAAGATGAACTCCACCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 3.40% 1.59% 0.00% NA
All Indica  2759 99.70% 0.20% 0.04% 0.00% NA
All Japonica  1512 85.20% 10.10% 4.70% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.60% 0.13% 0.00% NA
Temperate Japonica  767 72.10% 18.90% 9.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 96.30% 3.30% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124908110 C -> T LOC_Os11g41530.1 upstream_gene_variant ; 49.0bp to feature; MODIFIER silent_mutation Average:71.772; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N
vg1124908110 C -> T LOC_Os11g41540.1 upstream_gene_variant ; 3391.0bp to feature; MODIFIER silent_mutation Average:71.772; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N
vg1124908110 C -> T LOC_Os11g41540.2 upstream_gene_variant ; 3391.0bp to feature; MODIFIER silent_mutation Average:71.772; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N
vg1124908110 C -> T LOC_Os11g41540.3 upstream_gene_variant ; 3391.0bp to feature; MODIFIER silent_mutation Average:71.772; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N
vg1124908110 C -> T LOC_Os11g41540.4 upstream_gene_variant ; 3391.0bp to feature; MODIFIER silent_mutation Average:71.772; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N
vg1124908110 C -> T LOC_Os11g41530-LOC_Os11g41540 intergenic_region ; MODIFIER silent_mutation Average:71.772; most accessible tissue: Zhenshan97 young leaf, score: 81.353 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1124908110 C T -0.08 -0.04 -0.03 -0.03 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124908110 2.35E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 1.34E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 3.37E-06 NA mr1309 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 NA 1.05E-06 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 9.16E-07 NA mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 1.50E-07 1.50E-07 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 2.76E-07 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 8.46E-06 NA mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 1.76E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 8.91E-06 2.20E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 3.71E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 NA 3.35E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 4.02E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 NA 1.54E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 NA 8.31E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 7.36E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 8.37E-06 6.20E-06 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 4.74E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124908110 NA 5.20E-06 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251