\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124903385:

Variant ID: vg1124903385 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24903385
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


ACATATTTTGCATGTGTTGGACGAAAATGCCCTCATCTTCTACGTCTCTTCTTTCATCTTCTACCTCTCTCTTCCCAAATCCTGTCACCGGCGATGTCCG[C/T]
TGCGGGAGCTCGGAGCGCCGGATAGAACACCGCAGGTCCGCCATCCACCGAGGCTCTTCACGAAGGCCGTCCTCTGCTACGTCGGGGTTCGAGGCAGTCA

Reverse complement sequence

TGACTGCCTCGAACCCCGACGTAGCAGAGGACGGCCTTCGTGAAGAGCCTCGGTGGATGGCGGACCTGCGGTGTTCTATCCGGCGCTCCGAGCTCCCGCA[G/A]
CGGACATCGCCGGTGACAGGATTTGGGAAGAGAGAGGTAGAAGATGAAAGAAGAGACGTAGAAGATGAGGGCATTTTCGTCCAACACATGCAAAATATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 45.20% 0.55% 7.41% NA
All Indica  2759 33.80% 54.20% 0.51% 11.49% NA
All Japonica  1512 62.60% 35.40% 0.20% 1.79% NA
Aus  269 77.00% 19.70% 2.60% 0.74% NA
Indica I  595 12.90% 66.20% 0.17% 20.67% NA
Indica II  465 25.80% 71.40% 0.43% 2.37% NA
Indica III  913 50.80% 33.70% 0.33% 15.12% NA
Indica Intermediate  786 34.60% 58.70% 1.02% 5.73% NA
Temperate Japonica  767 85.80% 14.20% 0.00% 0.00% NA
Tropical Japonica  504 42.10% 52.40% 0.40% 5.16% NA
Japonica Intermediate  241 32.00% 67.20% 0.41% 0.41% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 46.70% 46.70% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124903385 C -> T LOC_Os11g41510.1 upstream_gene_variant ; 3959.0bp to feature; MODIFIER silent_mutation Average:49.212; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg1124903385 C -> T LOC_Os11g41520.1 downstream_gene_variant ; 363.0bp to feature; MODIFIER silent_mutation Average:49.212; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg1124903385 C -> T LOC_Os11g41530.1 downstream_gene_variant ; 3517.0bp to feature; MODIFIER silent_mutation Average:49.212; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg1124903385 C -> T LOC_Os11g41520-LOC_Os11g41530 intergenic_region ; MODIFIER silent_mutation Average:49.212; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg1124903385 C -> DEL N N silent_mutation Average:49.212; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124903385 NA 7.23E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124903385 NA 4.58E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124903385 NA 6.60E-07 mr1579 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124903385 7.66E-07 7.66E-07 mr1701 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124903385 NA 3.56E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124903385 NA 2.02E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124903385 1.83E-07 1.83E-07 mr1579_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124903385 NA 2.84E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124903385 NA 6.63E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251