\
| Variant ID: vg1124903385 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 24903385 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 88. )
ACATATTTTGCATGTGTTGGACGAAAATGCCCTCATCTTCTACGTCTCTTCTTTCATCTTCTACCTCTCTCTTCCCAAATCCTGTCACCGGCGATGTCCG[C/T]
TGCGGGAGCTCGGAGCGCCGGATAGAACACCGCAGGTCCGCCATCCACCGAGGCTCTTCACGAAGGCCGTCCTCTGCTACGTCGGGGTTCGAGGCAGTCA
TGACTGCCTCGAACCCCGACGTAGCAGAGGACGGCCTTCGTGAAGAGCCTCGGTGGATGGCGGACCTGCGGTGTTCTATCCGGCGCTCCGAGCTCCCGCA[G/A]
CGGACATCGCCGGTGACAGGATTTGGGAAGAGAGAGGTAGAAGATGAAAGAAGAGACGTAGAAGATGAGGGCATTTTCGTCCAACACATGCAAAATATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.90% | 45.20% | 0.55% | 7.41% | NA |
| All Indica | 2759 | 33.80% | 54.20% | 0.51% | 11.49% | NA |
| All Japonica | 1512 | 62.60% | 35.40% | 0.20% | 1.79% | NA |
| Aus | 269 | 77.00% | 19.70% | 2.60% | 0.74% | NA |
| Indica I | 595 | 12.90% | 66.20% | 0.17% | 20.67% | NA |
| Indica II | 465 | 25.80% | 71.40% | 0.43% | 2.37% | NA |
| Indica III | 913 | 50.80% | 33.70% | 0.33% | 15.12% | NA |
| Indica Intermediate | 786 | 34.60% | 58.70% | 1.02% | 5.73% | NA |
| Temperate Japonica | 767 | 85.80% | 14.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 42.10% | 52.40% | 0.40% | 5.16% | NA |
| Japonica Intermediate | 241 | 32.00% | 67.20% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 46.70% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124903385 | C -> T | LOC_Os11g41510.1 | upstream_gene_variant ; 3959.0bp to feature; MODIFIER | silent_mutation | Average:49.212; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg1124903385 | C -> T | LOC_Os11g41520.1 | downstream_gene_variant ; 363.0bp to feature; MODIFIER | silent_mutation | Average:49.212; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg1124903385 | C -> T | LOC_Os11g41530.1 | downstream_gene_variant ; 3517.0bp to feature; MODIFIER | silent_mutation | Average:49.212; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg1124903385 | C -> T | LOC_Os11g41520-LOC_Os11g41530 | intergenic_region ; MODIFIER | silent_mutation | Average:49.212; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| vg1124903385 | C -> DEL | N | N | silent_mutation | Average:49.212; most accessible tissue: Zhenshan97 young leaf, score: 77.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124903385 | NA | 7.23E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124903385 | NA | 4.58E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124903385 | NA | 6.60E-07 | mr1579 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124903385 | 7.66E-07 | 7.66E-07 | mr1701 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124903385 | NA | 3.56E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124903385 | NA | 2.02E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124903385 | 1.83E-07 | 1.83E-07 | mr1579_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124903385 | NA | 2.84E-06 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124903385 | NA | 6.63E-09 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |