\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124897837:

Variant ID: vg1124897837 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24897837
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATCTTTCGCATAGAGAATACGCCATCATGAAATTGTATATAATGATCATGTTTATGATCGGATGGCATATTATTCGGATTCTGAATGATCTGTCCGAG[A/G]
AGATTTATTATTCTTAAAGCACCTCCAACGTGAGGATTAAATCGAACCTAGCACGAAAATGTCGAACCAAATACATTGTGGGGGATGAATCATGACATGA

Reverse complement sequence

TCATGTCATGATTCATCCCCCACAATGTATTTGGTTCGACATTTTCGTGCTAGGTTCGATTTAATCCTCACGTTGGAGGTGCTTTAAGAATAATAAATCT[T/C]
CTCGGACAGATCATTCAGAATCCGAATAATATGCCATCCGATCATAAACATGATCATTATATACAATTTCATGATGGCGTATTCTCTATGCGAAAGATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 19.40% 2.18% 19.66% NA
All Indica  2759 61.70% 8.60% 1.92% 27.84% NA
All Japonica  1512 53.10% 44.00% 0.40% 2.51% NA
Aus  269 52.80% 0.40% 5.58% 41.26% NA
Indica I  595 82.20% 5.70% 0.67% 11.43% NA
Indica II  465 74.60% 2.60% 1.72% 21.08% NA
Indica III  913 44.70% 9.50% 2.52% 43.26% NA
Indica Intermediate  786 58.30% 13.10% 2.29% 26.34% NA
Temperate Japonica  767 18.50% 78.70% 0.26% 2.48% NA
Tropical Japonica  504 94.60% 4.40% 0.00% 0.99% NA
Japonica Intermediate  241 76.30% 16.20% 1.66% 5.81% NA
VI/Aromatic  96 72.90% 1.00% 22.92% 3.12% NA
Intermediate  90 64.40% 17.80% 7.78% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124897837 A -> DEL N N silent_mutation Average:40.544; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg1124897837 A -> G LOC_Os11g41500.1 upstream_gene_variant ; 4339.0bp to feature; MODIFIER silent_mutation Average:40.544; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg1124897837 A -> G LOC_Os11g41520.1 upstream_gene_variant ; 2130.0bp to feature; MODIFIER silent_mutation Average:40.544; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg1124897837 A -> G LOC_Os11g41510.1 downstream_gene_variant ; 764.0bp to feature; MODIFIER silent_mutation Average:40.544; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg1124897837 A -> G LOC_Os11g41500-LOC_Os11g41510 intergenic_region ; MODIFIER silent_mutation Average:40.544; most accessible tissue: Minghui63 root, score: 72.958 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124897837 NA 4.26E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 1.35E-06 NA mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 4.86E-14 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 2.55E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 7.71E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 2.00E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 6.33E-06 6.33E-06 mr1036_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 2.92E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 9.33E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 3.37E-33 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 3.36E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 5.32E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 2.62E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 5.63E-08 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 2.61E-06 NA mr1609_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 9.51E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 2.67E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 6.04E-12 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 2.72E-16 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 1.16E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897837 NA 3.85E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251