Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124897169:

Variant ID: vg1124897169 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24897169
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTACAGAGGAGACGTCGATAAGTCGGGGCTAAGGTACAGGACTAATAAATCTAATAGTTAAAACTAATAGATCCACCTATTTACTTAAGTGAAAATTGA[C/T]
GGTCAGAATTTTTTTTCTCATAATTTCTGTGATTTCTCTAATTTATTATAGCATCACGTAATGGCTTAGGAGTGCACTAAGTTTTAGTATATAACTAGGA

Reverse complement sequence

TCCTAGTTATATACTAAAACTTAGTGCACTCCTAAGCCATTACGTGATGCTATAATAAATTAGAGAAATCACAGAAATTATGAGAAAAAAAATTCTGACC[G/A]
TCAATTTTCACTTAAGTAAATAGGTGGATCTATTAGTTTTAACTATTAGATTTATTAGTCCTGTACCTTAGCCCCGACTTATCGACGTCTCCTCTGTAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.60%	2.20%	15.81%	46.38%	NA
All Indica	2759	12.40%	0.00%	20.73%	66.91%	NA
All Japonica	1512	72.50%	6.80%	6.28%	14.42%	NA
Aus	269	52.40%	0.00%	14.87%	32.71%	NA
Indica I	595	10.90%	0.00%	9.41%	79.66%	NA
Indica II	465	10.50%	0.00%	27.96%	61.51%	NA
Indica III	913	13.40%	0.00%	26.40%	60.24%	NA
Indica Intermediate	786	13.40%	0.00%	18.45%	68.19%	NA
Temperate Japonica	767	73.40%	12.10%	7.82%	6.65%	NA
Tropical Japonica	504	71.20%	1.00%	4.76%	23.02%	NA
Japonica Intermediate	241	72.20%	2.10%	4.56%	21.16%	NA
VI/Aromatic	96	66.70%	0.00%	25.00%	8.33%	NA
Intermediate	90	46.70%	0.00%	17.78%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124897169	C -> T	LOC_Os11g41500.1	upstream_gene_variant ; 3671.0bp to feature; MODIFIER	silent_mutation	Average:36.833; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1124897169	C -> T	LOC_Os11g41520.1	upstream_gene_variant ; 2798.0bp to feature; MODIFIER	silent_mutation	Average:36.833; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1124897169	C -> T	LOC_Os11g41510.1	downstream_gene_variant ; 1432.0bp to feature; MODIFIER	silent_mutation	Average:36.833; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1124897169	C -> T	LOC_Os11g41500-LOC_Os11g41510	intergenic_region ; MODIFIER	silent_mutation	Average:36.833; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1124897169	C -> DEL	N	N	silent_mutation	Average:36.833; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124897169	8.32E-09	4.99E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	1.44E-10	1.46E-06	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	1.78E-06	NA	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	7.18E-08	2.35E-06	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	2.28E-09	6.29E-07	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	1.05E-10	NA	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	1.57E-06	NA	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	7.06E-12	1.74E-08	mr1238_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	4.52E-07	NA	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	1.73E-09	1.73E-09	mr1484_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	6.82E-11	8.48E-08	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	5.04E-12	2.73E-08	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	4.52E-09	4.52E-09	mr1945_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169	2.17E-07	NA	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251