\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124897169:

Variant ID: vg1124897169 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24897169
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTACAGAGGAGACGTCGATAAGTCGGGGCTAAGGTACAGGACTAATAAATCTAATAGTTAAAACTAATAGATCCACCTATTTACTTAAGTGAAAATTGA[C/T]
GGTCAGAATTTTTTTTCTCATAATTTCTGTGATTTCTCTAATTTATTATAGCATCACGTAATGGCTTAGGAGTGCACTAAGTTTTAGTATATAACTAGGA

Reverse complement sequence

TCCTAGTTATATACTAAAACTTAGTGCACTCCTAAGCCATTACGTGATGCTATAATAAATTAGAGAAATCACAGAAATTATGAGAAAAAAAATTCTGACC[G/A]
TCAATTTTCACTTAAGTAAATAGGTGGATCTATTAGTTTTAACTATTAGATTTATTAGTCCTGTACCTTAGCCCCGACTTATCGACGTCTCCTCTGTAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.60% 2.20% 15.81% 46.38% NA
All Indica  2759 12.40% 0.00% 20.73% 66.91% NA
All Japonica  1512 72.50% 6.80% 6.28% 14.42% NA
Aus  269 52.40% 0.00% 14.87% 32.71% NA
Indica I  595 10.90% 0.00% 9.41% 79.66% NA
Indica II  465 10.50% 0.00% 27.96% 61.51% NA
Indica III  913 13.40% 0.00% 26.40% 60.24% NA
Indica Intermediate  786 13.40% 0.00% 18.45% 68.19% NA
Temperate Japonica  767 73.40% 12.10% 7.82% 6.65% NA
Tropical Japonica  504 71.20% 1.00% 4.76% 23.02% NA
Japonica Intermediate  241 72.20% 2.10% 4.56% 21.16% NA
VI/Aromatic  96 66.70% 0.00% 25.00% 8.33% NA
Intermediate  90 46.70% 0.00% 17.78% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124897169 C -> T LOC_Os11g41500.1 upstream_gene_variant ; 3671.0bp to feature; MODIFIER silent_mutation Average:36.833; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1124897169 C -> T LOC_Os11g41520.1 upstream_gene_variant ; 2798.0bp to feature; MODIFIER silent_mutation Average:36.833; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1124897169 C -> T LOC_Os11g41510.1 downstream_gene_variant ; 1432.0bp to feature; MODIFIER silent_mutation Average:36.833; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1124897169 C -> T LOC_Os11g41500-LOC_Os11g41510 intergenic_region ; MODIFIER silent_mutation Average:36.833; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1124897169 C -> DEL N N silent_mutation Average:36.833; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124897169 8.32E-09 4.99E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 1.44E-10 1.46E-06 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 1.78E-06 NA mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 7.18E-08 2.35E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 2.28E-09 6.29E-07 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 1.05E-10 NA mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 1.57E-06 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 7.06E-12 1.74E-08 mr1238_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 4.52E-07 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 1.73E-09 1.73E-09 mr1484_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 6.82E-11 8.48E-08 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 5.04E-12 2.73E-08 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 4.52E-09 4.52E-09 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124897169 2.17E-07 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251