\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124893228:

Variant ID: vg1124893228 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 24893228
Reference Allele: AAlternative Allele: G,AGG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAGGCAGCAGCTGACGACGCCTTCTTTACCCTTAGCTTCAGCGCATTCCCGCTTCCGGCAGGTTTGAGCAGTCGAGGATAACGATGAAATTCTGAAGA[A/G,AGG]
GAAGAGCGATGAAAGGCTGGTGGTGGACTGTTGGTGAAGTGGACTGTTGCATCACCGTTGGTGAAGTGGATGATCCTGTCGTCGCTTTCGTAGATTCCTG

Reverse complement sequence

CAGGAATCTACGAAAGCGACGACAGGATCATCCACTTCACCAACGGTGATGCAACAGTCCACTTCACCAACAGTCCACCACCAGCCTTTCATCGCTCTTC[T/C,CCT]
TCTTCAGAATTTCATCGTTATCCTCGACTGCTCAAACCTGCCGGAAGCGGGAATGCGCTGAAGCTAAGGGTAAAGAAGGCGTCGTCAGCTGCTGCCTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 18.10% 0.36% 0.00% AGG: 0.32%
All Indica  2759 97.00% 2.80% 0.00% 0.00% AGG: 0.25%
All Japonica  1512 62.70% 37.30% 0.00% 0.00% NA
Aus  269 47.60% 43.10% 6.32% 0.00% AGG: 2.97%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.50% 1.30% 0.00% 0.00% AGG: 0.22%
Indica III  913 95.50% 4.40% 0.00% 0.00% AGG: 0.11%
Indica Intermediate  786 95.50% 3.80% 0.00% 0.00% AGG: 0.64%
Temperate Japonica  767 87.10% 12.90% 0.00% 0.00% NA
Tropical Japonica  504 34.50% 65.50% 0.00% 0.00% NA
Japonica Intermediate  241 44.00% 56.00% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124893228 A -> G LOC_Os11g41500.1 missense_variant ; p.Phe16Leu; MODERATE nonsynonymous_codon ; F16P Average:83.075; most accessible tissue: Zhenshan97 root, score: 95.062 unknown unknown TOLERATED 0.19
vg1124893228 A -> AGG LOC_Os11g41500.1 frameshift_variant ; p.Phe16fs; HIGH frameshift_variant Average:83.075; most accessible tissue: Zhenshan97 root, score: 95.062 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1124893228 A AGG 0.39 0.06 0.02 0.2 0.31 0.25
vg1124893228 A G 0.1 0.05 0.03 0.02 0.05 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124893228 NA 1.55E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 5.39E-08 2.65E-15 mr1609 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 6.64E-06 6.64E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 3.41E-06 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 NA 5.56E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 1.03E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 NA 2.52E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 NA 1.36E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 NA 3.38E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 NA 7.19E-08 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 9.26E-08 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 9.40E-07 9.40E-07 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 NA 3.66E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 1.68E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 3.01E-09 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 NA 9.31E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 NA 5.34E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124893228 NA 5.25E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251