\
| Variant ID: vg1124890479 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 24890479 |
| Reference Allele: G | Alternative Allele: GAA,A,GAAATTAGCCACGTAGGCGCC,GAAATT,GAAATTAGCCACGT |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGAGGAAATCGACCCTATCTTCTAATAAATTTGCTTCGGTCTAGTAAAAAGTATCTCGAGTTACCGGTATCTCACGGTACCAAATCGTTTCCGATCATTG[G/GAA,A,GAAATTAGCCACGTAGGCGCC,GAAATT,GAAATTAGCCACGT]
ATCTAGTTGGGCAGGATGCGCATTATTAGATCCAACGATCGGAAACGATTTAGTACCGTGAGCTACCGATACCTCGAGGTACTTTTTGTTGGACCGGAGC
GCTCCGGTCCAACAAAAAGTACCTCGAGGTATCGGTAGCTCACGGTACTAAATCGTTTCCGATCGTTGGATCTAATAATGCGCATCCTGCCCAACTAGAT[C/TTC,T,GGCGCCTACGTGGCTAATTTC,AATTTC,ACGTGGCTAATTTC]
CAATGATCGGAAACGATTTGGTACCGTGAGATACCGGTAACTCGAGATACTTTTTACTAGACCGAAGCAAATTTATTAGAAGATAGGGTCGATTTCCTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.60% | 0.30% | 0.76% | 0.00% | GAA: 0.13%; GAAATT: 0.08%; GAAATTAGCCACGTAGGCGCC: 0.08%; GAAATTAGCCACGT: 0.02% |
| All Indica | 2759 | 99.50% | 0.20% | 0.14% | 0.00% | GAA: 0.04%; GAAATT: 0.04%; GAAATTAGCCACGTAGGCGCC: 0.04% |
| All Japonica | 1512 | 97.90% | 0.50% | 1.12% | 0.00% | GAA: 0.20%; GAAATTAGCCACGTAGGCGCC: 0.13%; GAAATT: 0.07%; GAAATTAGCCACGT: 0.07% |
| Aus | 269 | 94.40% | 0.00% | 4.83% | 0.00% | GAAATT: 0.37%; GAA: 0.37% |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.40% | 0.33% | 0.00% | GAAATT: 0.11% |
| Indica Intermediate | 786 | 99.50% | 0.10% | 0.13% | 0.00% | GAAATTAGCCACGTAGGCGCC: 0.13%; GAA: 0.13% |
| Temperate Japonica | 767 | 99.30% | 0.30% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 0.80% | 2.18% | 0.00% | GAA: 0.60%; GAAATTAGCCACGTAGGCGCC: 0.40%; GAAATTAGCCACGT: 0.20%; GAAATT: 0.20% |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 2.08% | 0.00% | GAA: 1.04%; GAAATTAGCCACGTAGGCGCC: 1.04% |
| Intermediate | 90 | 98.90% | 0.00% | 0.00% | 0.00% | GAAATT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124890479 | G -> A | LOC_Os11g41490.1 | upstream_gene_variant ; 803.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> A | LOC_Os11g41480.1 | downstream_gene_variant ; 4735.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> A | LOC_Os11g41500.1 | downstream_gene_variant ; 2324.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> A | LOC_Os11g41490-LOC_Os11g41500 | intergenic_region ; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATTAGCCACGTAGGCGCC | LOC_Os11g41490.1 | upstream_gene_variant ; 804.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATTAGCCACGTAGGCGCC | LOC_Os11g41480.1 | downstream_gene_variant ; 4736.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATTAGCCACGTAGGCGCC | LOC_Os11g41500.1 | downstream_gene_variant ; 2323.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATTAGCCACGTAGGCGCC | LOC_Os11g41490-LOC_Os11g41500 | intergenic_region ; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATTAGCCACGT | LOC_Os11g41490.1 | upstream_gene_variant ; 804.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATTAGCCACGT | LOC_Os11g41480.1 | downstream_gene_variant ; 4736.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATTAGCCACGT | LOC_Os11g41500.1 | downstream_gene_variant ; 2323.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATTAGCCACGT | LOC_Os11g41490-LOC_Os11g41500 | intergenic_region ; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATT | LOC_Os11g41490.1 | upstream_gene_variant ; 804.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATT | LOC_Os11g41480.1 | downstream_gene_variant ; 4736.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATT | LOC_Os11g41500.1 | downstream_gene_variant ; 2323.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAAATT | LOC_Os11g41490-LOC_Os11g41500 | intergenic_region ; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAA | LOC_Os11g41490.1 | upstream_gene_variant ; 804.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAA | LOC_Os11g41480.1 | downstream_gene_variant ; 4736.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAA | LOC_Os11g41500.1 | downstream_gene_variant ; 2323.0bp to feature; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1124890479 | G -> GAA | LOC_Os11g41490-LOC_Os11g41500 | intergenic_region ; MODIFIER | silent_mutation | Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124890479 | 6.06E-09 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | 9.18E-07 | 4.02E-07 | mr1238 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | 7.13E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | 1.85E-07 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | 2.28E-06 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | 1.09E-09 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | 5.25E-06 | 5.25E-06 | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | 4.98E-08 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | 1.91E-07 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | 7.89E-08 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | NA | 8.57E-06 | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124890479 | 7.83E-07 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |