\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124890479:

Variant ID: vg1124890479 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 24890479
Reference Allele: GAlternative Allele: GAA,A,GAAATTAGCCACGTAGGCGCC,GAAATT,GAAATTAGCCACGT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGGAAATCGACCCTATCTTCTAATAAATTTGCTTCGGTCTAGTAAAAAGTATCTCGAGTTACCGGTATCTCACGGTACCAAATCGTTTCCGATCATTG[G/GAA,A,GAAATTAGCCACGTAGGCGCC,GAAATT,GAAATTAGCCACGT]
ATCTAGTTGGGCAGGATGCGCATTATTAGATCCAACGATCGGAAACGATTTAGTACCGTGAGCTACCGATACCTCGAGGTACTTTTTGTTGGACCGGAGC

Reverse complement sequence

GCTCCGGTCCAACAAAAAGTACCTCGAGGTATCGGTAGCTCACGGTACTAAATCGTTTCCGATCGTTGGATCTAATAATGCGCATCCTGCCCAACTAGAT[C/TTC,T,GGCGCCTACGTGGCTAATTTC,AATTTC,ACGTGGCTAATTTC]
CAATGATCGGAAACGATTTGGTACCGTGAGATACCGGTAACTCGAGATACTTTTTACTAGACCGAAGCAAATTTATTAGAAGATAGGGTCGATTTCCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.60% 0.30% 0.76% 0.00% GAA: 0.13%; GAAATT: 0.08%; GAAATTAGCCACGTAGGCGCC: 0.08%; GAAATTAGCCACGT: 0.02%
All Indica  2759 99.50% 0.20% 0.14% 0.00% GAA: 0.04%; GAAATT: 0.04%; GAAATTAGCCACGTAGGCGCC: 0.04%
All Japonica  1512 97.90% 0.50% 1.12% 0.00% GAA: 0.20%; GAAATTAGCCACGTAGGCGCC: 0.13%; GAAATT: 0.07%; GAAATTAGCCACGT: 0.07%
Aus  269 94.40% 0.00% 4.83% 0.00% GAAATT: 0.37%; GAA: 0.37%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.40% 0.33% 0.00% GAAATT: 0.11%
Indica Intermediate  786 99.50% 0.10% 0.13% 0.00% GAAATTAGCCACGTAGGCGCC: 0.13%; GAA: 0.13%
Temperate Japonica  767 99.30% 0.30% 0.39% 0.00% NA
Tropical Japonica  504 95.60% 0.80% 2.18% 0.00% GAA: 0.60%; GAAATTAGCCACGTAGGCGCC: 0.40%; GAAATTAGCCACGT: 0.20%; GAAATT: 0.20%
Japonica Intermediate  241 97.90% 0.80% 1.24% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 2.08% 0.00% GAA: 1.04%; GAAATTAGCCACGTAGGCGCC: 1.04%
Intermediate  90 98.90% 0.00% 0.00% 0.00% GAAATT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124890479 G -> A LOC_Os11g41490.1 upstream_gene_variant ; 803.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> A LOC_Os11g41480.1 downstream_gene_variant ; 4735.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> A LOC_Os11g41500.1 downstream_gene_variant ; 2324.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> A LOC_Os11g41490-LOC_Os11g41500 intergenic_region ; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATTAGCCACGTAGGCGCC LOC_Os11g41490.1 upstream_gene_variant ; 804.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATTAGCCACGTAGGCGCC LOC_Os11g41480.1 downstream_gene_variant ; 4736.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATTAGCCACGTAGGCGCC LOC_Os11g41500.1 downstream_gene_variant ; 2323.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATTAGCCACGTAGGCGCC LOC_Os11g41490-LOC_Os11g41500 intergenic_region ; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATTAGCCACGT LOC_Os11g41490.1 upstream_gene_variant ; 804.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATTAGCCACGT LOC_Os11g41480.1 downstream_gene_variant ; 4736.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATTAGCCACGT LOC_Os11g41500.1 downstream_gene_variant ; 2323.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATTAGCCACGT LOC_Os11g41490-LOC_Os11g41500 intergenic_region ; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATT LOC_Os11g41490.1 upstream_gene_variant ; 804.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATT LOC_Os11g41480.1 downstream_gene_variant ; 4736.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATT LOC_Os11g41500.1 downstream_gene_variant ; 2323.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAAATT LOC_Os11g41490-LOC_Os11g41500 intergenic_region ; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAA LOC_Os11g41490.1 upstream_gene_variant ; 804.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAA LOC_Os11g41480.1 downstream_gene_variant ; 4736.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAA LOC_Os11g41500.1 downstream_gene_variant ; 2323.0bp to feature; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1124890479 G -> GAA LOC_Os11g41490-LOC_Os11g41500 intergenic_region ; MODIFIER silent_mutation Average:52.594; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124890479 6.06E-09 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 9.18E-07 4.02E-07 mr1238 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 7.13E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 1.85E-07 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 2.28E-06 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 1.09E-09 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 5.25E-06 5.25E-06 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 4.98E-08 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 1.91E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 7.89E-08 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 NA 8.57E-06 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124890479 7.83E-07 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251